- Strength to Increase Rep
- +5
- Strength to Decrease Rep
- -1
- Upvotes Received
- 5
- Posts with Upvotes
- 5
- Upvoting Members
- 4
- Downvotes Received
- 7
- Posts with Downvotes
- 5
- Downvoting Members
- 6
Re: Hi all, Something disturbing is happening... I make an AJAX call to a page and it returns unprocessed PHP, not HTML. However, when I navigate to the page manually, the PHP is processing as expected. This must be a huge security vulnerability? My AJAX call is: $('#forgot').click(function(e){ e.preventDefault(); lFormContainer.load("ajax/?page=authenticate/username"); }); … | |
Re: I am supposed to submit my final year project title within 3days. I think i am finished cause till now,i have totally no clue about it. In our University,no titles are given for final year project therefore, We are supposed to choose wat we are interested in. This make it … | |
Hi all, My cpp is rusty as all get out and I'm wondering why this doesn't seem to work. I've basically created a .cpp file with all of the structs and lower level data types in it. One of these is an enumerated type. The file. structs.cpp is as follows: … | |
Re: hiii, i am doing my final year project in Face recognition using laplacianfaces. if any body has done this technique then please help me out.. i dont know how to find the k-nearest neighbors and thus the similarity matrix between images... please reply me anybody who ha some IDEA OR … | |
I posted this on Oracle Forums to the sound of crickets chirping. This question entails more Oracle specific tasks then java but since my code is in java, here goes" Hello, I have a java package where I am attempting to implement a database Change notification registration and listener. I … | |
Re: I’m tired of Paying Too Much for Music,I wish i could Download all my favorite Music to my computer, play them on my iPod, PSP, Zune, etc and save hundreds or even thousands per year.[COLOR="Red"]But how can I download free music?[/COLOR] thanks for your help! | |
Re: Just installed 64-bit Windows 7 Home Premium. So far so good. I did a fresh install, reformatted the hard drive, and installed fresh. | |
Hi all, UDATE: Let's not hastily rush into this. I may have found my problem. BTW, my result set is populated with all of the required data. I have a custom renderer which renders table cell values from a query. The result data is populated into a 2 dimensional array. … | |
Hey there, I'm getting ready to release my Beta version of a java project you've all been so helpful with. There is one problem though. I haven't the foggiest idea how to package the jnlp. Where do the compiled libraries reside? Are they part of a binary? What is launched … | |
Hi all, I am rather new to PHP, but have a fairly ok grasp of software design. My question arises from the fact that I'm getting ready to deploy some scripts etc. to my website which is hosted on a *nix type server. My home / work computer that I'm … | |
Re: I have been asked to find the inefficiency in a piece of pseducode. I've looked at it but can't see it. IF count > 10 THEN WHILE x < 0 DO INPUT x ENDWHILE ENDIF My understanding: Count is evaluated. If count is <10, the app moves onto the next … | |
Re: i am new to this kind of programming. please help me,. i got an IP address (32bits) & 3 int (32 X 3 = 96bits) totaling for 128bits i.e., 16bytes. my problem here is, how to club them all together to create a 16byte string. please help. thanks in advance | |
Re: I have a list like this: name1: group1 name2: group4 name3: group1 group2 name4: group4 .......... .......... I wish to invert this list, and make it look like: group1: name1 name3... group2: name3 group4: name2, name4 ........... ........... Can somebody offer at least a psuedo code? Thanks | |
Re: how to create a mutlipication table in java program for example: enter x=5 enter y =6 output is: 1*6=6 2*6=12 3*6=18 4*6=24 5*6=30 | |
Re: I remember vaguely hearing about [URL="http://www.scientificblogging.com/administrator/earth_shattering_proof_of_continents_on_the_move"]this[/URL] when it happened but now that more data is in I am just amazed. I can't wait - I plan on watching this develop over the next few centuries. Here is a good image of where it is forming in the Rift Valley: | |
In Design mode in NetBeans IDE, I had a palette with all of my AWT and Swing controls and some netbeans that I can drag and drop onto the Jframe I'm designing, I accidentally closed it. I am not seeing a menu option anywhere to add that palette back as … | |
Re: I know some people are against converting jars to exes, but I needed to in this case. The jar worked fine but my exe gives me the error below. The code is just, [CODE]package mail; import java.net.*; import java.io.*; public class Mail { public static void main(String[] args) { System.out.println(args.length); … | |
Re: hi all how are u? i have a problem and i need your help ..i have a code in java that connect to a mysql DB and update the rows of the table ...but i have a problem ...the new updated column called (original_text) contains the updated columnss from the … | |
Not really sure how to phrase the question. Essentially my issue is this: I have a Form that when the user clicks a button, it invokes a JFrame that populates a datatable with a sql query. The datable frame also has a button. The user can select a cell in … | |
Re: I have a algorithm problem to ask: There are N persons, and each of them knows one distinct gossip message. The two of them just make a phone call, so they could share messages they know. Then at least how many phone calls do they need make , so that … | |
Re: Hi, I have strings like this: [code] $string="OWN - NLM STAT- Publisher DA - 20091005 AU - Gannon AM AU - Turner EC AU - Reid HM AU - Kinsella BT AU- XYZ AD - UCD School of Biomolecular and Biomedical Sciences"; [/code] I want to parse these tags and … | |
Re: Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many … | |
Re: I am working on an assignment and I need a bit of help. I am using a double linked list to find roots of polynomials, the list has a trailer node only. I can't seem to get it to create a list. I figure I am just missing something small … | |
Re: hi to everybody. I'm just wonderin' if someone can help me with arrays. I am making a program of computing an average grade. I manage to execute the first requirements. The problem i have is how can i compute the grades that had been entered using a seperate method here … | |
Re: Working on a project that is basically a simple bowling program that uses a gui to read in from a given text file a pre-determined amount of names and scores...runs through the standard 10 frame scoring system, prints out the score, and who won. Now I can't seem to get … | |
Re: I have to make a psuedocode or a flowchart to create a multiple-control break program. The Specifications: You are given an input file that contains the following information: * Title * Author * Category * Publisher * Price * BookCity * BookState Produce a report that totals the number of … | |
Re: Hello, I'm novice in computer science , please bear with me. I have studied some embedded systems and now I have just started learning PC programming in C . My question is when one complies a C program it is converted into a binary file right? That is machine language, … | |
Re: If I have 2 classes a) class Business b) class Customer I want the Business class to be able to store a dynamic list of it's customers. So I thought the easiest way to do this would be to use a vector. [code] class Business { vector<Customer> customers; public: Business(); … | |
Hello all, I am writing a java application where I have a Jtable with checkboxes next to the data. If the user checks a box, I want to store a specific value from the data table. I can do this inelegantly by setting setCellSelectionEnabled(true) and adding the following to the … |