15,190 Topics

Member Avatar for
Member Avatar for dinesh5

how do i create a simple interface with two buttons and a picture in the backgroud in python

Member Avatar for lllllIllIlllI
0
86
Member Avatar for bvrclvr1

Hi All, I'm extremely new to Python and would like to create a program to help automate some of the things I do at work. I need to take information from an IDX shell and create a word document with it. Does this sound possible? Would anyone be interested in …

Member Avatar for lllllIllIlllI
0
190
Member Avatar for gotrobotfriends

Hi all I was wondering if someone can let me know of a quick and easy way of interacting with a Javascript control on a web page. "<a href="#p189191" name="option66" onclick="selectPollOption(66);" class="vote">Vote</a>" That's the control I would like to activate, I was thinking I could use a regular expression to …

Member Avatar for gotrobotfriends
0
98
Member Avatar for adam291086

[CODE]#!/usr/bin/python # e begoli, python connector for mysql # import MySQL module import MySQLdb # connect db = MySQLdb.connect(host = "localhost", user = "adamplo1", passwd = "U7RJM5HQ", db = "adamplo1_UniProject") # create a database cursor cursor = db.cursor() # execute SQL select statement cursor.execute("SELECT * FROM User") # get the …

Member Avatar for Stefano Mtangoo
0
113
Member Avatar for grambo

Alright this is my first program in python, so be gentle. I have 2 files I need to basically combine to create a record in mysql. Features.txt has around 1300 records and property.txt has about 25,000 records. I can read in property.txt fine and get my insert statements. My problem …

Member Avatar for jlm699
0
127
Member Avatar for adam291086

I am trying to send a message using SOAP. Everything seems to work but no message comes through. I get no error message at all here is my code [CODE]#!/usr/bin/python from SOAPpy import WSDL print "Content-type: text/html\n" wsdlFile = 'http://www.adamplowman.com/sendservice.wsdl' server = WSDL.Proxy(wsdlFile) username = 'adamplowman' password = 'DreamOn' destination …

Member Avatar for adam291086
0
141
Member Avatar for myself2211

Hi, just beginning to learn Python, and am trying to create a script that will output matches from a text file to a user's input, I have managed that so far, the problem I have is trying to have something returned if the user puts in a string of text …

Member Avatar for myself2211
0
232
Member Avatar for Cali45

I am fairly new to Python and trying towork on this problem. I want to split the file which contains two seuqence of letters by the blank line that separates them then 'compare' them: What you need to do: Text file genesequences.txt contains two gene sequences, separated from each other …

Member Avatar for jlm699
0
92
Member Avatar for adam291086

Hello, I am reading this turorial [url]http://diveintopython.org/soap_web_services/introspection.html[/url] and i am trying to echo out all my wsdl method. I am trying to do this on my external web hosting server. I have got the modules installed but i am getting an internal server error [url]http://adamplowman.com/cgi-bin/test_xml.py[/url] here is the code [CODE] …

0
85
Member Avatar for SoulMazer

First off, I know that to set an indexed variable, say, mylist[3] = "Hello". I also know that you wouldn't be able to set mylist[3] if you didn't first state: [code = python]mylist = ["Whatever", "Whatever", "Whatever", "Whatever"][/code] But, if you had a variable with an extremely large index, it …

Member Avatar for SoulMazer
0
84
Member Avatar for jcafaro10

I can't really seem to find a jython forum and this question is somewhere between a jython and a python question. I'm trying to get a java Scanner in python. So in java I say myInterpretter.exec("import java.util") and then in python I try and access jav.util.Scanner but it says java …

Member Avatar for Stefano Mtangoo
0
76
Member Avatar for MaxVK

Hi there. I started with wxPython (Under Linux) a little while ago and I'm enjoying very much, however, there doesn't seem to be a control for working with Rich text. Iv found a few articles (mostly dated a few years ago) that suggest that such a control is on its …

Member Avatar for MaxVK
0
387
Member Avatar for serious123

Hi, I am trying to run a python(2.5.1) script on apache2. Basically, I want that when I run this script in the browser on the web server, a gnome windows pops up. The code is as follows: [code] import subprocess def launchExplorer(): path = '/home/robot/Music' command = ["/usr/bin/gnome-open",path] subprocess.call(command) if …

0
47
Member Avatar for OutOfReach

I am creating a tetris-like game. I have decided to use coordinates (x,y) along with a dictionary. Here is a part of the dictionary: [CODE=Python] gameTable = {(-5,10):0,(-4,10):0,(-3,10):0,(-2,10):0,(-1,10):0,(0,10):0, (1,10):0, (2,10):0, (3,10):0, (4,10):0, (5,10):0, (-5,9):0, (-4,9):0, (-3,9):0, (-2,9):0, (-1,9):0, (0,9):0, (1,9):0, (2,9):0, (3,9):0, (4,9):0, (5,9):0, (-5,8):0, (-4,8):0, (-3,8):0, (-2,8):0, (-1,8):0, (0,8):0, …

Member Avatar for Ene Uran
0
205
Member Avatar for chebude

I am a bigginer in python and even programming. I want to use python in my thesis for reading and writing large size data. I have a little sample of code which access which runs over the lines and reads each element on a line. [ICODE]def get_site_only(pat): newpat = "" …

Member Avatar for jlm699
0
109
Member Avatar for lllllIllIlllI

Hi everyone, I have been fiddling around with a speech recognition program for a while now and i always had something that bothered me. Here is my code i have been using. It is the example code from code.activestate.com [code=python] from win32com.client import constants import win32com.client import pythoncom """Sample code …

Member Avatar for lllllIllIlllI
0
760
Member Avatar for Bouzy210

I am trying to have the user of this script define what html tag they want printed from a document and then print all lines between those tags. e.g. [ICODE] <html> <p>;lasdjf;lsdakjf</p>[/ICODE] if users raw input is <p> I want to print ';lasdjf;lsdakjf' Right now it doesn't print anything but …

Member Avatar for jlm699
0
149
Member Avatar for chg

Hello all, I'll start by saying please bear with me, I am very new to python and I need some help takeing a string with mixed letters and numbers and converting it to a INT. For example [code=python] stringname = '105 mV' [/code] I would like '105 'striped from the …

Member Avatar for crono5788
0
148
Member Avatar for ihatehippies

Currently running python 2.6, wxpython 2.8 unicode win32 on the vista platform... When I try to run a sample app in the wx tutorial section the program stops responding as soon as I mouse over it. Heres the code. [CODE=python]import wx """Example with a 2D grid of sizers of sorts …

Member Avatar for Stefano Mtangoo
0
151
Member Avatar for Stefano Mtangoo

Hello all, greetings! I have been playing with DB, seom time ago and want to resume soon where i got stuck. I want to make MySQLdb to get working with wxpython GUI. I got stuck on how to attach the tuple I got from select command to series to the …

Member Avatar for Stefano Mtangoo
0
77
Member Avatar for samkasarla_nz

Hi , I have a question .. I would like to write/modify the my program ... i.e writing a function to find out which of the directories exists ..... for example : on my computer c:\\sam and in another mechine c:\\xyz ... only one dir should on my computer or …

Member Avatar for jlm699
0
89
Member Avatar for sourceofthought

Hello there Sorry in advance if this post is to big, not sure where else to go. I have just started out with python (last 2wks) with no previous Programming background. I have been really excited with the possibility of been able to program with python and to hopefully develop …

Member Avatar for sourceofthought
0
120
Member Avatar for vmars

Greetings: I am chugging thru Boa Help Getting Started Guide for Boa Constructor , Kevin Gill , November 1, 2000 and am at Section: 2.7 Creating a Dialog Window doing everything as specified in Help, Save/Run and click on Help/About , no Dialog comes up. [Frame2.py , App2.py , Dialog2.py] …

Member Avatar for vmars
0
312
Member Avatar for ihatehippies

I'm fairly new to making GUI's in tk so I downloaded activestates GUI builder from sourceforge. It has a very straightforward drag and drop interface and is easy to pick up. However I ran into a problem trying to edit the widgets it creates. It makes 2 files, the first …

Member Avatar for ihatehippies
0
107
Member Avatar for drjekil

Planning to Write a script that reads a Fasta-formatted file and writes the number of sequences in it, followed by the accessions of the sequences. For example, if the input is >Pig ACGT >Dog AGTG >Bunny TATA then the output should be 3 Pig Dog Bunny any idea?

Member Avatar for Gribouillis
0
85
Member Avatar for drjekil

I ve to Write a Python program that prints a random DNA sequence in Fasta format. That program should ask for the length of the sequence and suggest a reasonable sequence name. The session should look something like: > python randomdna.py Length: 34 >MySequence TGCGCATATTGTCTAACTATGGCTGTGGCCGGA The output must be in …

Member Avatar for drjekil
0
157
Member Avatar for kaisoze

Probley a really simple one ive got the basis of the Dijkstra’s algorithm [CODE] # findRoute - dijkstra's algorithm. # def findRoute(source, dest): global theGraph theGraph.reset(source) while theGraph.get () != []: u = theGraph.getBestChoice(source) theGraph.addVisited(u) if u == dest: return True for v in theGraph.getNode(u).getNeighbours(): theGraph.addChoice(v) alt = theGraph.getNode(u).getDistanceFrom(source) + …

Member Avatar for jlm699
0
114
Member Avatar for paferlini

Hi all, im a beginner, and i need to have fields in a website , soh that users can write on them.. and then i need to get these values and process them in an python program... im lost.. no ideia where to start... anyone can give me a tip? …

Member Avatar for jlm699
0
93
Member Avatar for Weebl4551

Hi. I just joined this forum because I really need some quick advice on a Blackjack game I'm working on. It's my first major endeavor, and I can't quite get it to work right. Here's the code. #blackjack.py from cards import * from graphics import * import random DIM = …

Member Avatar for jlm699
0
185
Member Avatar for srinivasanb4u
0
66

The End.