2,452 Topics
![]() | |
AH 1106 AH 11989 AH 121 BH 120 BH 220 CH 330 I want result like AH 1160 11989 121 BH 120 220 CH 330 | |
So i was wondering if it is possible to make something <a class='photo' href=<?PHP 'lala.php?blu=$q&subf=$subf&img=$imagenr' ?> target='_blank'> <span><img src=<?PHP'{$handle}/{$file}'?> /></span></a> lala.php is already made with all needed, but when i'm trying to make something with this code it doesnt show up the photo. I named class photo so i can … | |
Hi, I have 2 files. I need to read a line from the File 1 and check for it in File 2. If it is present, I need to delete that line from File 2. File 1 A1 B1 C1 File 2 A1 ABCDEF S1 EEE C1 EFGH D1 XYQ … | |
Hi all, Requirement: - I have a perl script that I need to run for several hours, for a performance test. - I would like to create a second script in ANSI C to call the perl script. The C script should be able to parse any of the text … | |
so i was trying to make a binary tree program. just inserting and deleteing. some how i messed up. i think insertion is ok till level 1 after that stays on level 1 only. also the function to delete the whole tree is not working. it only deletes node at … | |
**I develop a simple asp.net application.My grid has autogenerate columns,i want to pass my last cell value in grid to hyperlink** | |
I have a text file containing contents like 1 A 0 -1 -2 -3 -4 2 A -1 2 3 -4 -5 So I read the file and used split function as @a=split(/ /,$_) and took each line into array a. But now when I take these into array a … | |
Hi, I have a sytem path like "C:\Users\ABC\XYZ\1.txt". I need to convert this to 'C:\Users\ABC\XYZ\1.txt'. Any help is appretiated. Thank you. | |
I have a Seagate 500GB external hard drive that has been put in a new casing after some wires in the original came loose. I only got it back two days ago. So today I plugged it into my macbook and everything was fine, and then suddenly the warning/error window … | |
Hi, let say that i have this excel file that contains column of account number and the name of the customer. And I want to extract any of the data that have duplicate. And the script should be able to get the duplicate only if the both of the account … | |
Hello; While this script working, in case of not to connect a node ("BADYK01","BAGRK01", "BAHLK01", "BAHLK02", "BAHLK03") , it stops. I want it to be continue even if it doesnt connect a node. I mean if it couldnt connect to BAGRK01, I want it to be continue and connect the … | |
#!/usr/bin/perl -w use Win32::OLE qw(in with); use Win32::OLE::Const 'Microsoft Excel'; $Win32::OLE::Warn = 3; # die on errors... # get already active Excel application or open new my $Excel = Win32::OLE->GetActiveObject('Excel.Application') || Win32::OLE->new('Excel.Application', 'Quit'); # get a new workbook $book = $ex->Workbooks->Open('C:\Users\Andrew Babitt\Documents\ProductClonesTest.xls'); $Obook = $ex->Workbooks->Open('C:\Users\Andrew Babitt\Documents\NSS\extract_Products.xls'); my $billschedule = $Obook->clumn(B)->{value}; … | |
Hi. I am currently in a position where I am having to learn Perl in the context of developing a website using Embperl. I am at a point where I have a few subroutines that I would like to try off-loading to a separate file and then including that file … | |
When I try open links in outlook i get the following error message - 'Contact your system administrator due to restrictions in effect on my computer' This is a Windows 7 pc running outlook 2010 and using an Exchange 2010 mailbox. any ideas? Thanks | |
hi, when i try to multiply the double value with 100, i got inconsistent o/ps.. here the codes... Case1:- double d=15.025d; System.out.println("d="+(d*100)); o/p:-d=1502.5 Case 2:- double d=16.025d; System.out.println("d="+(d*100)); o/p:- d=1602.4999999999998 and this issue to 17.025,18.025,19.025 & 20.025 also. it suppose to be d=1602.5 right? why these particular o/p and how … | |
Not sure if this can be done. There are word files in a directory with all familiar names. i.e. fr001, fr002, fr003, etc... all with the extension .doc. I would like to know is there a code that will link an excel file to a directory and then be able … | |
Hi, Anyone here know how to compare the old array data from database with the new array data also from the same databse? Please help me. Its urgent.. :( | |
Im trying to get my program to look like the following Welcome to the 64th Primetime Emmy Awards! ============================================================================== The nominees for Outstanding Comedy Series are: [1] Write In [2] The Big Bang Theory, CBS [3] Curb Your Enthusiasm, HBO [4] Girls, HBO [5] 30 Rock, NBC [6] Veep, HBO … | |
Hey Guys So in my work, I create an excel spreadsheet. The spreadsheet has cells with hyperlinks in them. When clicked on, the user is taken to another cell within the spreadsheet. Sort of like an anchor. So I was reading on the web that there are no free PDF … | |
Hello hi. I am seeing flames with using FILESTREAM in SQL Server 2008! I have a table (Products), in which I wanna store a link to an image stored on disk, under the ProdPicture column. This is what the script looks like: CREATE TABLE PRODUCTS ( ProdID INT PRIMARY KEY, … | |
I have installed Qt on my ubuntu laptop and I get nothing but errors compiling .cpp files with <QApplication> preprocessor directives. I am new to using Qt and are reading a book online about it hosted here: http://www.informit.com/articles/article.aspx?p=1405562 Specific error i have obtained running g++ hello.cpp -o hello: hello.cpp:1:24: fatal … | |
Hi, I have a file containing multiple-headed data (input file 1), and also a second file containing elements for searching the first file. input file 1: UROPA sseD 1.2.3.3.3 crimson ddsU 2.1.4.1.2 green SAMEL aadH 7.4.1.1.1 blue uuoG 10.1.2.3.4 white MOONA gmaL 3.4.1.6.7 red oolJ 9.1.1.4.1 yellow input file 2: … | |
Hi, I need to search a particular string in a CSV file ("STPSTR01.134") the line that contains this string. I need to divide the 13th column by the 14th column. Any help would be very much appreciated. I'm using ActivePerl for windows /csv file allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.134;900;FALSE;SCANNER;10;3471;6288;11093;10419;588480;631296;0;254004;316732;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.58;900;FALSE;SCANNER;10;20652;23514;39497;29404;4690132;3929776;0;3471992;2947904;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.60;900;FALSE;SCANNER;10;20593;19351;36274;26039;4350820;3462084;0;3234956;2593056;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.62;900;FALSE;SCANNER;10;24237;21229;40003;28678;5122408;3703840;0;3875508;2746088;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.26;900;FALSE;SCANNER;10;18538;20644;35833;26421;4075280;3588768;0;2979124;2707892;0 ![]() | |
Hi, I've got a set of folders with each contain many files. I need to extract a specific file extention(.sof) from each of these folders to a new directory(or the same directory in a new folder). Any help is appreciated. Thanks. | |
I am going to work on building a database application. One part of this is parsing pdf files which will feed the data into the database. Will be using SQLite build it C which has wrappers for Perl so there's not problem there. From what I understand, Perl is a … ![]() | |
I am trying to send sms through Way2sms using Perl LWP. The login part is being successful, after which I save the cookies to a local file. The welcome page after being logged in shows a Send SMS link, clicking on which one is redirected to another page with two … | |
I need help in using a variable passed in a hyperlink query string to do PHP query of a MySQL database. I want use the variable to query the database and return the unique row field data to display in a table The hyperlink is: [CODE]http://www.site.com/bios.php?pc=ab [/CODE] After connecting to … | |
I am trying to write a script to grab images from my CCD camera. I can already do this with C++ usung VFW and OpenGL, but I want to find a way to do it with Perl. It needs to be able to run on windows though. I am pretty … | |
I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly … | |
Hi Daniweb, I've been using perl for Regex recently and I want to know is it possible to create an Excel Movie Library with the movie poster, the name of that file and a hyperlink of that clip is attached to the poster. Any help is appreciated. thanks. |
The End.