2,452 Topics
 | |
| | hi, i have the following xml : <ADR> <Resolvers InitOnlyUsedResolvers="Yes"> <Resolver Name="LD" ClassName="com.comverse.mms.adr.resolvers.LDResolver"/> <Resolver Name="NPM" ClassName="com.comverse.mms.adr.resolvers.NPMResolver"/> <Resolver Name="LZR" ClassName="com.comverse.mms.adr.resolvers.LZRResolver"/> <Resolver Name="Validator"ClassName="com.comverse.mms.adr.resolvers.ValidatorResolver"/> <Resolver Name="NonSub" ClassName="com.comverse.mms.adr.resolvers.NonSubResolver"/> <Resolver Name="VASRR" ClassName="com.comverse.mms.adr.resolvers.VASRNGResolver"/> [COLOR="red"]<[B]Resolver Type="Plugin" Name="AdrPlug" ClassName="AdrLdapConnector"/>[/B][/COLOR] </Resolvers> </ADR> i need to add to the above xml the line in red on this exact place. i … |
| | I have an assignment to create a class Purse and print the coins in the purse, reverse the sequence of the coins, transfer the contents of one purse to another, and compare to see if two purses have the same contents. I have the following code but the transfer is …  |
| | Hi, I have excel sheet which contain 100 and 100 of email and corresponding name. I need to seprate them according to the number of occurrence of their name. eg: name email chandran [email]chan@gmail.com[/email] maidhu maidu2yahho.com karan [email]karniii@nii.in[/email] Chandran [email]chan@gmail.com[/email] Chandran [email]chan@gmail.com[/email] karan [email]karniii@gmail.com[/email] excell sheet contain name and email, … |
| | Hi, I wrote this script to help me cleanup some data. The value in the 8th column is sometimes empty. When it is empty, I want it to print a zero as in the next part of the script it will be adding a number to whatever is in that … |
| | Hi how to export perl script results to HTML files? |
| | I'm not sure how it's done, but I need a link to change an attribute so that the main content page can get the attribute and then display the appropriate content. My following code does not work...and it always seems to include home.jsp no matter what (home is set from … |
| | How do I call the following Perl script from an HTML page? wget --user=user --password=password <camera IP>/cgi/mjpg/mjpg.cgi I am trying to access video on a Trendnet IP410 camera for display on the page and eliminate the requirement for input of a User and P/W. Any help will be most welcome. … |
| | Hi, Friends I am vasant from Ahmedabad, India. I am using Windows Xp with IE 7. I am using google to find ebooks & pdf files, Because it takes too much time to open PDF in browser itself, so i always save PDF file just be rightclicking (from the results …  |
| | In my website based on MVC...I need to create one user control...in that there can be any no of widgets. I want to make all widgets draggable and save its positions so that when the page is reloaded, all widgets come at their respective positions.. Upto this I have done … |
| | I attempted to overload the == operator for one of my classes, I even copied a previous implementation of it, but now that I am using pointers it refuses to function properly here is the relevant code (there is a lot so I will provide more if need be) [CODE]#ifndef … |
| | So heres my problem: I have a datagrid w/ 5 columns(ID, firstname, lastname, Membership, Date). My app takes a 5 digit number from the user and with that number populates my datagrid with the members information. My BIGGEST problem is trying to check to see if the member is already … |
 | Hi, I am learning Python, and I was just wondering whether Python can achieve everything PHP can. I don't know PHP, but I know it's a server side scripting language, and it is often embedded in HTML pages. Can Python be used in the same manner, i.e. embedded in HTML … |
| | hey, i have no experience with pearl programming what so ever, but at work i have to use the code below to change csv to xls files. could someone tell me in the code below which line specifies the .csv file name that i need to change in order to …  |
| | every time i try to run my program (driver) is receive the following error message, arithmetic.pm did not return a true value at ./driver line 9, begin failed--compilation aborted at ./driver line 9 can anyone help me sort this out? thank you very much [CODE]#!/usr/bin/perl -w #Driver #program by James … |
| | Hello , the problem is this, i need to install the XML-LibXML library and it seems to be easier to put salt in your eyes than to realize this. I get the error below which basically states that i cannot install the library because i don't have libxml2 installed. Of … |
| | So, i need help to do couple of things: [B]1.[/B] To change the hyperlink into a button. The link downloads the file from the server, which is pointed in the database. Below is the actual code of the hyperlink, and what I tried to do, to change it to a … |
| | Hi All, I am trying to find matches wherever there is an ip address in the xsl and xml files under a parent directory(It contains subdirectories as well). In MS Dos below command doesnt work. Could anyone please give me the perl snippet to find the ip address matches? findstr … |
| | Hello, I have a question. I found a script on the Internet that lets people change from one language to another, in this case from English to French, but files must all reside in the same folder. The script works, however, my files are in seperate folders in the root, … |
| | Hi, If it's not too much trouble I would appreciate some help with this: How I can read one by ane all xml files in one directory and to have options to get same elemests from xml files :) For example: [CODE] chdir("/ras-events/Emanuila/edrs/") or die "Couldn't open directory"; opendir (DIR, … |
| | I have two computers, one a laptop with Windows Vista the other Mac Snow Leopard both receive the same mail when ever mail comes to my address. [U]Occasionally[/U] I receive mail from a friend arriving on the Vista computer it's fine. When it arrives in the Mac it has hyperlinks … |
| | Dear all, I need to copy a set of files every once in a while from my build env to a shared drive. The set of files are same, names may vary but they come with same extension. So far I am doing it manually. I wish it could be …  |
| | Im learning a new language , perl, and am wondering what are some useful perl systems admin scripts? What are some scripts sys admins write to automate tasks etc.. any ideas, id like to learn the usefulness other than perls ability for "quick and dirty" programs. thanks! |
| | hi.. i used this code to display a clock. [CODE]<script type="text/javascript"> var int=self.setInterval("clock()",1000); function clock() { var d=new Date(); var t=d.toLocaleTimeString(); document.getElementById("apDiv1").innerHTML=t; } </script>[/CODE] in firefox it displays like this 7:25:00 PM and in Chrome 19:25:39 i want to show a similar clock as in firefox in Chrome. How can … |
| | Hi, I made the perl script and I print out with Txt file. For EX : [CODE]Open (OUTPUT,">data.txt"));[/CODE] out put [CODE]data.txt[/CODE] But I hope at the day that I run the script, the day will be labeled with the name file. Like the name below: [CODE]20110919data.txt[/CODE] Could you please show … |
| | i have a script for greenstone applciation mkcol.pl here it is: [CODE]#!/usr/bin/perl -w ########################################################################### # # mkcol.pl -- # A component of the Greenstone digital library software # from the New Zealand Digital Library Project at the # University of Waikato, New Zealand. # # Copyright (C) 1999 New Zealand … |
| | Hi, I have the data file. txt (3.96 MB) and I want to make each 50 Character on the one line. For EX: In put data : [CODE]GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC........ [/CODE] [CODE] out put with 50 character on one line: GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCC TGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCG GAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGA AGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGAT GCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATC CCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCT CAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC [/CODE] Below is my script … |
| | Hi, I have a code (below) that reads from a file and output the file content a fter inserting a tab and & in-between different elements into another file. [CODE]my $REPORT_FILE = 'report.txt'; $allRfile = 'AllidentifiedMetabs1.txt'; open(ALL,"<AllidentifiedMetabs1.txt") || die "can't open $allRfile $!"; my $line = <ALL>; ($ID,$name,$M2, $M3, $M4, … |
| | Hi Everyone, Can anyone pls help me out......with my requirement, i am struggling since 3 days. Please find the requirement below my file contains below data Code: R1|Array/Network Resistor - VIP|V_RES_CLASS|V_MOUNT_FEATURE|SURFACE MOUNT|AND|8533.10.00.20|8533.10.00.20| R1|Array/Network Resistor - VIP|V_RES_NW_CLASS|V_TECHNOLOGY|CARBON*||8533.10.00.20|8533.10.00.20| R4|Array/Network Resistor - VIP|V_RES_CLASS|V_MOUNT_FEATURE|THROUGH HOLE MOUNT|AND|8533.10.00.57|8533.10.00.57| R4|Array/Network Resistor - VIP|V_RES_NW_CLASS|V_TECHNOLOGY|CARBON*||8533.10.00.57|8533.10.00.57| R7|Array/Network Resistor - VIP|V_RES_CLASS|V_MOUNT_FEATURE|SURFACE … |
| | Hello, I'd really like some help on this. How can I add the server's root folder of "english" to this: [B]~ s/_e\.shtml/_f\.shtml/ [/B] This searches all occurences of [B]_e.shtml[/B] and replaces them with [B]_f.shtml[/B] (it being in the same folder). Yet, in between that, I would like to add the … |
| | Hello, Please help me to do this. i take one combobox in modelpopop. but it is not working properly. textbox is Display properly but right side button not display. there is not problem in css. because i put same combobox in simple page. outside modelpopup. Please help me. Jack |
 | hello, I want to link a text file in my userform. [B]Can i use linklabel for hyperlink?[/B] please help me........... thanks in advance.:confused: |
| | I wrote c program that outputs all permutations of a word to a txt file. ate aet tae tea eat eta I also have a txt file of all the words in the dictionary. I would like to take the first entry in permutations.txt and search dictionary.txt to see if … |
| | Sir / Madam, I would like to map and extract common numbers between 5 column (i.e.Start) and 6th column (End) for refFlat table with 2nd column (Start) and 3rd column (End) for mirna table. Could you please modify the script attach here. I would be glad for your support. With … |
| | hi, [CODE]print "<tr><td><b>click</b></td><td><a href=test.php?id=$id&code=$pcode&name=$pname§ion=$psection target=\"_blank\">Click</a></td></tr>"; [/CODE] I am passing all the values to test.php through hyperlink. Problem is: I can able to get only id and code. $pid=$_REQUEST['id']; // values getting $pcode=$_REQUEST['code']; //values getting $pname=$_REQUEST['name']; // values not getting $psection=$_REQUEST['section]; // values not getting I don't know to find what …  |
| | hello to all i am seo and link building worker, not expert, but doing backlink can obtain google page rank, but still i am not sure that when we put signature in forum or blog or put link in different website,what is the best benefits to write keywords in a … |
| | [CODE]use strict; use warnings; use IO::Socket; my $sock = new IO::Socket::INET( PeerAddr=> 'localhost', PeerPort=> '7070', Proto => 'tcp'); die "Could not create socket: $!\n" unless $sock; my $run = "yes"; while($run eq "yes") { my $text = <STDIN>; print $sock "$text"; print "Send more strings? yes/no"; $run = <STDIN>; } … |
| | ok i have a perl script [CODE]use strict; use warnings; open(my $in, ">>", "log.txt") or die "cant open log.txt $!" ; my @files = <*>; foreach my $file (@files){ print $in $file . "\n"; } close $in or die "$in $!";[/CODE] it gets the filenames that are in the same … |
| | Hi, How to add message in the queue using Perl script? Please give example. Thanks in advance. |
| | Hello, My dropdown menu is not working properly. I have set the menu to not display through css. When I hover my mouse on the 'Link Menu' <h2>, it only shows the menu while the mouse is hovering the 'Link Menu' <h2>. As soon as I move my mouse to … |
| | I am trying to write a multi-window text editor. I have a Page Control containing 20 pages, and each page (tab sheet) contains an instance of my editor. Which works mostly ok, except I sometimes get weird results when painting my editor window. The attached code is a greatly cut-down … |
 | Hi All, Has anybody worked with extracting an image from RSS/Atom Feeds using Perl There is a modulke XML::RSS which extracts images from RSS feeds. But in Atom feeds the images are embedded in the description using the img tag. Need some help on extracting the image from the description … |
| | Hi, So I am modifying some code from discussion thread: [URL="http://www.daniweb.com/software-development/perl/threads/323871"]http://www.daniweb.com/software-development/perl/threads/323871[/URL] I am still very much a newbie, but am trying to get a better handle on hashes - so if I've messed mine up please tell me ;). I am attaching 3 files. One is an image of the … |
| | I have a perl application.In one of the low level scripts, it's possible that it must "logout" the user.Basically, exit the shell that this application is running. Are there Any ideas on how to accomplish this?  |
| | [CODE]<?xml version="1.0" encoding="[CONTENT_ENCODING/]"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="[LANG_CODE/]" lang="[LANG_CODE/]" dir="[BASE_DIRECTION/]"> <head> <meta http-equiv="Content-Type" content="[CONTENT_TYPE/]" /> <title>Micro Customer Care</title> <style type="text/css"> body { padding:0; margin:0; } </style> [STYLE_SHEETS/] <!--[if lt IE 7]> <link rel="stylesheet" type="text/css" href="css/ie5-6.css"/> <![endif]--> <script src="js/chat.js" type="text/javascript" charset="UTF-8"></script> <script src="js/lang/[LANG_CODE/].js" type="text/javascript" charset="UTF-8"></script> … |
| | Hi ALL, I am writing a script to retreive entries from a DB. And then I loop through all the entries. Once I am done looping through all the result sets, I have to re-loop over them again. This is done in an infinite loop (Please don't ask why to … |
| | Hi everyone, Coul you please help me to find the position between Star_poso and end_posi. I have two data Data 1: Num Posi 1 2 2 5 3 9 4 16 5 19 .. .. Data 2: Num Star_posi End_posi 1 1 10 2 15 18 3 26 30 .. … |
| | [code] #pragma comment(lib, "crypt32.lib") #include <stdio.h> #include <windows.h> #include <Wincrypt.h> #include <iostream> #define MY_ENCODING_TYPE (PKCS_7_ASN_ENCODING | X509_ASN_ENCODING) //this is keylength bit shifted, here we have keylength of 1024bits hence 1024 << 16; #define KEYLENGTH 0x04000000 using namespace std; int main() { DWORD dwFlags = 0; HCRYPTPROV m_hProv; PBYTE pbKeyBlob; DWORD … |
| | Hi, I am trying to open a file and correct the spelling of friend. But when I open the file test.txt again it is all blank. [CODE] my $opened = open(MYFH , ">test.txt"); my $line; my $lnum = 1; while( $line = <MYFH> ){ print "$lnum: $line\n"; $line =~ s/freind/friend/g; … |
| | hello, i want to parse a file that has the following log entries [code] 1183245991.961 0.079 137.157.56.34 200 1277 GET http://linux.pacific.net.au/linux/packman/suse/10.2/repodata/repomd.xml "text/xml" 1183327698.250 2.568 137.157.56.212 200 57891 GET http://csc3-2004-crl.verisign.com/CSC3-2004.crl "application/pkix-crl" 1183328737.107 0.570 137.157.56.223 301 777 GET http://www.starnet.com/expiredialog/demo.php?product_name=xwin32&time_remain=1800&version=8.0.2216&locale=en_AU&w32iso639ulang=en&uuid={dfe167ce-f51c-4fd4-af80-25f31246f6bc} "text/html" 1183328737.908 0.781 137.157.56.139 200 5696 GET http://www.starnet.com/expiredialog/demo.php/xwin32/1800?version=8.0.2216&locale=en_AU&w32iso639ulang=en&uuid=%7bdfe167ce-f51c-4fd4-af80-25f31246f6bc%7d "text/html" 1183328738.777 0.759 137.157.56.91 200 … |
| | Dear All, Can any one tell me how to convert the IP address from dec to hex decimal. For Ex: 255.102.25.02/32 should look like FF661902 since its 32 bit 255.102.25.02/31 should derive two values FF661902, FF661903 since its 31 bit |
The End.