15,194 Topics
![]() | |
I know how to create a window of a given size. How do I control the placement of items like labels and text boxes in that window? | |
Hi, I want to know if is possible to make those events/automation with a Python code( without any program like Pywinauto ), so I could compile the python code: 1. [B]sending keys to an active window;[/B] 2. [B]sending mouse clicks to specific coordinates in a window;[/B] 3. [B]set the window … | |
Hi Guys! I'm new to the forum and I have a doubt. Who can help me, I thank you. This is a simple GUI .. formed by a simple table. How do I connect to a database file. Db so that is shown in table QtGui? I'm using SQLite in … | |
[CODE]def prel(x, i, j): if (i < j - 1): k1 = (j - i + 1) / 3 k2 = 2 * k1 prel(x, i, i + k1) prel(x, i + k1 + 1, i + k2) prel(x, i + k2 + 1, j) for k in range(i, j): … | |
I discovered and installed a firefox addon called Remote Control. This addon starts a telnet server which lets you send javascript commands to the firefox web browser. Combined with python telnetlib module, it becomes very easy to reload or change the content of a tab in a running firefox from … | |
Hi, I'm pretty new to Python. Working in 2.4 due to company restraints. I'm trying to use os.path.walk to work through a tree directory, and perform different actions on the files based on the name of the file. I thought if I used "startwith" it would indicate that files only … | |
| |
Stuck again, this time my problem is getting the dictionary to be sorted in ascending order. Please Advise! the following is what the task says: """ A sparse vector is a vector whose entries are almost all zero, like [1, 0, 0, 0, 0, 0, 0, 2, 0]. Storing all … | |
I want to run a multiline AppleScript command from a Python script. For a singleline command I can do: [CODE]def stupidtrick(): os.system(cmd) cmd = """osascript -e 'tell app "Finder" to sleep'""" stupidtrick(); [/CODE] however I want to run multiline commands, (such as with multiple 'tell' statements, as in [ICODE]tell application … | |
I just started learning python and decided to try and put what I have learned to use in a program and I am having issues with the math I believe. Any suggestions? [CODE] print ("Lets get some utlities information") rent=input("What is your monthly rent: $") pge=input("Estimated PG&E Bill: $") water=input("Estimated … | |
hi, i'm very new to python. i downloaded pyserial on win7 64bit. using Dell N5010 (it doesn't really have serial port) i tried to open port with ser = serial.Serial(0) but it gave error that [COLOR="red"][Error 2] The system cannot find the file specified.[/COLOR] but with ser = serial.Serial(3) and … | |
Hi, I'm trying to extract certain things from a web page. The website is TVRage.com, and the example I'm using at the moment is [URL="http://www.tvrage.com/Warehouse_13/episode_list"]the Warehouse 13 episode list[/URL]. So far I've managed to get the title of the show using this code: [CODE]#!/usr/bin/env python import urllib def save_page(site="http://www.tvrage.com/Warehouse_13/episode_list"): mypath … | |
Stuck again, still, im learning from my large list of mistakes, haha so this time im trying to convert a decimal to hexadecimal, i tried using hex(number) but its not suitable for the situation as this returns a string. and i dont know how or if i can convert a … | |
I tried many times but no luck. I want to parse a text file with a vcard format (from my phone contacts). the text file looks like this: BEGIN:VCARD VERSION:2.1 REV:20110913T095232Z UID:aac119d5fe3bc9dc-00e17913379d6cc8-3 N;X-EPOCCNTMODELLABEL1=First name:;[B]Maj[/B];;; TEL;VOICE:[B]09120000000[/B] X-CLASS:private END:VCARD BEGIN:VCARD VERSION:2.1 REV:20110228T083215Z UID:aac119d5fe3bc9dc-00e17b0693898c98-4 N;X-EPOCCNTMODELLABEL1=First name:;[B]Ali jahan[/B];;; TEL;VOICE:[B]09120000001[/B] X-CLASS:private END:VCARD BEGIN:VCARD VERSION:2.1 REV:20110228T083510Z … | |
![]() | ok i'm not sure if i can use regex to do this it'd be great if you can give some suggestions! i have a list of pure numbers in one hand and another list of also numbers but with dashes. it's like this: list1 = [245366556346,4534525326562,56345254234237... list2 = [75465-54224-4,3-55-342526,.... as … |
Greetings, I found the equivalent of this in Java but not Python. What i'm trying to figure out is how to reverse and print each of 5 lines in a text file backwards. I am able to take this: Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod … | |
Hello, I would consider myself a decent python programmer (this may or may not be true). In the past, I have had a few small python contracts and have been screwing around with the language for a few years (I also have experience with c++, java/html/css/javascript/etc). What I would really … | |
Hi. I have the below code that update a 'dirpath' and 'cobdate'(calendar) field from a website. When I look at the results from my python script. I can see the correct 'dirpath'. The date value selected is correct(as 2012-01-16) but when it posts or submit, the date comes up incorrectly(20120116) … | |
Hello all, Long time reader, first time poster here. I've been a web programmer for some time now but really never got into any scripting languages, I guess you could say I was just a web designer. Either way I want to write a little web server in Python to … | |
[B]Hiding .exe file inside JPEG using python3[/B] Hi I would like to hide calc.exe inside the jpg and when I click to my JPEG I would like the calc.exe will execute. My python script do this 1.hide calc.exe file inside jpeg. 2.run calc.exe when I open my jpeg. [B]I will … | |
Hello all , I just need to create a folder in an other machine using ssh or samba ; for example i execute : [CODE]os.mkdir( rachid@rachid:/home/rachid/Bureau/new, 0777 ); [/CODE] but It shows the next error : [QUOTE]OSError: [Errno 2] No such file or directory: 'rachid@rachid:/home/rachid/Bureau/new'[/QUOTE] Thank you for answering . | |
I am trying to convert a 2d image to 3d one in python. please introduse me some good source or if there is an open source program. Thanks alot. | |
I have text file as follows seq.txt >S1 AACAAGAAGAAAGCCCGCCCGGAAGCAGCTCAATCAGGAGGCTGGGCTGGAATGACAGCG CAGCGGGGCCTGAAACTATTTATATCCCAAAGCTCCTCTCAGATAAACACAAATGACTGC GTTCTGCCTGCACTCGGGCTATTGCGAGGACAGAGAGCTGGTGCTCCATTGGCGTGAAGT CTCCAGGGCCAGAAGGGGCCTTTGTCGCTTCCTCACAAGGCACAAGTTCCCCTTCTGCTT CCCCGAGAAAGGTTTGGTAGGGGTGGTGGTTTAGTGCCTATAGAACAAGGCATTTCGCTT CCTAGACGGTGAAATGAAAGGGAAAAAAAGGACACCTAATCTCCTACAAATGGTCTTTAG TAAAGGAACCGTGTCTAAGCGCTAAGAACTGCGCAAAGTATAAATTATCAGCCGGAACGA GCAAACAGACGGAGTTTTAAAAGATAAATACGCATTTTTTTCCGCCGTAGCTCCCAGGCC AGCATTCCTGTGGGAAGCAAGTGGAAACCCTATAGCGCTCTCGCAGTTAGGAAGGAGGGG TGGGGCTGTCCCTGGATTTCTTCTCGGTCTCTGCAGAGACAATCCAGAGGGAGACAGTGG ATTCACTGCCCCCAATGCTTCTAAAACGGGGAGACAAAACAAAAAAAAACAAACTTCGGG TTACCATCGGGGAACAGGACCGACGCCCAGGGCCACCAGCCCAGATCAAACAGCCCGCGT CTCGGCGCTGCGGCTCAGCCCGACACACTCCCGCGCAAGCGCAGCCGCCCCCCCGCCCCG GGGGCCCGCTGACTACCCCACACAGCCTCCGCCGCGCCCTCGGCGGGCTCAGGTGGCTGC GACGCGCTCCGGCCCAGGTGGCGGCCGGCCGCCCAGCCTCCCCGCCTGCTGGCGGGAGAA ACCATCTCCTCTGGCGGGGGTAGGGGCGGAGCTGGCGTCCGCCCACACCGGAAGAGGAAG TCTAAGCGCCGGAAGTGGTGGGCATTCTGGGTAACGAGCTATTTACTTCCTGCGGGTGCA CAGGCTGTGGTCGTCTATCTCCCTGTTGTTC >S2 ACACGCATTCACTAAACATATTTACTATGTGCCAGGCACTGTTCTCAGTGCTGGGGATAT AGCAGTGAAGAAACAGAAACCCTTGCACTCACTGAGCTCATATCTTAGGGTGAGAAACAG TTATTAAGCAAGATCAGGATGGAAAACAGATGGTACGGTAGTGTGAAATGCTAAAGAGAA AAATAACTACGGAAAAGGGATAGGAAGTGTGTGTATCGCAGTTGACTTATTTGTTCGCGT TGTTTACCTGCGTTCTGTCTGCATCTCCCACTAAACTGTAAGCTCTACATCTCCCATCTG TCTTATTTACCAATGCCAACCGGGGCTCAGCGCAGCGCCTGACACACAGCAGGCAGCTGA CAGACAGGTGTTGAGCAAGGAGCAAAGGCGCATCTTCATTGCTCTGTCCTTGCTTCTAGG AGGCGAATTGGGAAATCCAGAGGGAAAGGAAAAGCGAGGAAAGTGGCTCGCTTTTGGCGC TGGGGAAGAGGTGTACAGTGAGCAGTCACGCTCAGAGCTGGCTTGGGGGACACTCTCACG CTCAGGAGAGGGACAGAGCGACAGAGGCGCTCGCAGCAGCGCGCTGTACAGGTGCAACAG CTTAGGCATTTCTATCCCTATTTTTACAGCGAGGGACACTGGGCCTCAGAAAGGGAAGTG CCTTCCCAAGCTCCAACTGCTCATAAGCAGTCAACCTTGTCTAAGTCCAGGTCTGAAGTC CTGGAGCGATTCTCCACCCACCACGACCACTCACCTACTCGCCTGCGCTTCACCTCACGT GAGGATTTTCCAGGTTCCTCCCAGTCTCTGGGTAGGCGGGGAGCGCTTAGCAGGTATCAC CTATAAGAAAATGAGAATGGGTTGGGGGCCGGTGCAAGACAAGAATATCCTGACTGTGAT TGGTTGAATTGGCTGCCATTCCCAAAACGAGCTTTGGCGCCCGGTCTCATTCGTTCCCAG CAGGCCCTGCGCGCGGCAACATGGCGGGGTCCAGGTGGAGGTCTTGAGGCTATCAGATCG GTATGGCATTGGCGTCCGGGCCCGCAAGGCG . . . . I … | |
So i was busy playing around with the python module MySQLdb and looking at sql injection. [CODE] import MySQLdb def hack(name): db=MySQLdb.connect('xxx','xxx','xxx','xxx') cursor=db.cursor() sql="SELECT * FROM PLAYERS WHERE NAME = %s" %(name) print sql cursor.execute(sql) print cursor.fetchall() [/CODE] i entered Hack("'pete' OR '1'='1'") results were: SELECT * FROM PLAYERS WHERE … | |
1. (10 points) Using string method find, extract the Video link from the following HTML code for embedding videos on a web page. Your code should work for any embedded code of this format. <embed src="http://www.youtube.com/v/Xp2uzv9uSn8?version=3&feature=pl ayer_detailpage" type="application/x-shockwave-flash" allowfullscreen="true" allowScriptAccess="always" width="640" height="360"> 2. (10 points) In the Disney cartoon adaptation … | |
Please give me ideas why would I get following errors: [code] Traceback (most recent call last): File "C:\temp_Jag\FilePickling.py", line 3, in <module> unpickledlist = pickle.load(unpicklefile) File "C:\Python26\lib\pickle.py", line 1370, in load return Unpickler(file).load() File "C:\Python26\lib\pickle.py", line 858, in load dispatch[key](self) File "C:\Python26\lib\pickle.py", line 1142, in load_pop_mark k = self.marker() File … | |
Hi, I am just begining my adventure(if i may call it this way) with python used for web development. I found out that there are two well known frameworks: django and pylons. I read about them a lot, but I am not certain which one to pick. That's why I … | |
Hello everyone , i am trying to write a python code which will setup user quota for a user home directory...... i am successful in completing all the basic configuration, like entry in fstab file running quotacheck command.... The only issue which i am facing is of edquota command .... … | |
first off... a litte explanation as to what I'm doing... this is basically a way for me to create an update system for my program... the webhost I'm using allows hot-file linkage, so there's nothing that's improper... (except for my compy not having net) anyways... the structure I have for … | |
These two functions compute the orders of the lowest bit and the highest bit set in the binary representation of an integer. I expect them to handle securely very large integer values. |
The End.