Hallo everyone
im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example
my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac)
so i have to make a perl script showing the user how many t's , a's , c's and g's he typed , what a mean , if the user of the perl script type CTGACTGACGTACGTACGTA , the perl script have to show him how many a's t's c's and g's he typed ....
hoping for help ,,, thanks a lot
wannagethelp 0 Newbie Poster
Recommended Answers
Jump to Posttry something like:
$tcount; $acount; $gcount; $ccount; foreach $letter (@DNA) { if (($letter eq "t" ) || ($letter eq "T")) { $tcount++: } and so on
Jump to Post$input =~ s/$char/$char/gi would be more appropriate.
All 8 Replies
eggmatters 21 Junior Poster in Training
d5e5 109 Master Poster
ithelp 757 Posting Virtuoso Banned
wannagethelp 0 Newbie Poster
d5e5 109 Master Poster
vbharathi 3 Newbie Poster
eggmatters 21 Junior Poster in Training
wich -2 Newbie Poster
Be a part of the DaniWeb community
We're a friendly, industry-focused community of developers, IT pros, digital marketers, and technology enthusiasts meeting, networking, learning, and sharing knowledge.