2,452 Topics
 | |
| | hi, i have the following xml : <ADR> <Resolvers InitOnlyUsedResolvers="Yes"> <Resolver Name="LD" ClassName="com.comverse.mms.adr.resolvers.LDResolver"/> <Resolver Name="NPM" ClassName="com.comverse.mms.adr.resolvers.NPMResolver"/> <Resolver Name="LZR" ClassName="com.comverse.mms.adr.resolvers.LZRResolver"/> <Resolver Name="Validator"ClassName="com.comverse.mms.adr.resolvers.ValidatorResolver"/> <Resolver Name="NonSub" ClassName="com.comverse.mms.adr.resolvers.NonSubResolver"/> <Resolver Name="VASRR" ClassName="com.comverse.mms.adr.resolvers.VASRNGResolver"/> [COLOR="red"]<[B]Resolver Type="Plugin" Name="AdrPlug" ClassName="AdrLdapConnector"/>[/B][/COLOR] </Resolvers> </ADR> i need to add to the above xml the line in red on this exact place. i … |
| | I have an assignment to create a class Purse and print the coins in the purse, reverse the sequence of the coins, transfer the contents of one purse to another, and compare to see if two purses have the same contents. I have the following code but the transfer is …  |
| | Hi, I have excel sheet which contain 100 and 100 of email and corresponding name. I need to seprate them according to the number of occurrence of their name. eg: name email chandran [email]chan@gmail.com[/email] maidhu maidu2yahho.com karan [email]karniii@nii.in[/email] Chandran [email]chan@gmail.com[/email] Chandran [email]chan@gmail.com[/email] karan [email]karniii@gmail.com[/email] excell sheet contain name and email, … |
| | Hi, I wrote this script to help me cleanup some data. The value in the 8th column is sometimes empty. When it is empty, I want it to print a zero as in the next part of the script it will be adding a number to whatever is in that … |
| | Hi how to export perl script results to HTML files? |
| | I'm not sure how it's done, but I need a link to change an attribute so that the main content page can get the attribute and then display the appropriate content. My following code does not work...and it always seems to include home.jsp no matter what (home is set from … |
| | How do I call the following Perl script from an HTML page? wget --user=user --password=password <camera IP>/cgi/mjpg/mjpg.cgi I am trying to access video on a Trendnet IP410 camera for display on the page and eliminate the requirement for input of a User and P/W. Any help will be most welcome. … |
| | Hi, Friends I am vasant from Ahmedabad, India. I am using Windows Xp with IE 7. I am using google to find ebooks & pdf files, Because it takes too much time to open PDF in browser itself, so i always save PDF file just be rightclicking (from the results …  |
| | In my website based on MVC...I need to create one user control...in that there can be any no of widgets. I want to make all widgets draggable and save its positions so that when the page is reloaded, all widgets come at their respective positions.. Upto this I have done … |
| | I attempted to overload the == operator for one of my classes, I even copied a previous implementation of it, but now that I am using pointers it refuses to function properly here is the relevant code (there is a lot so I will provide more if need be) [CODE]#ifndef … |
| | So heres my problem: I have a datagrid w/ 5 columns(ID, firstname, lastname, Membership, Date). My app takes a 5 digit number from the user and with that number populates my datagrid with the members information. My BIGGEST problem is trying to check to see if the member is already … |
 | Hi, I am learning Python, and I was just wondering whether Python can achieve everything PHP can. I don't know PHP, but I know it's a server side scripting language, and it is often embedded in HTML pages. Can Python be used in the same manner, i.e. embedded in HTML … |
| | hey, i have no experience with pearl programming what so ever, but at work i have to use the code below to change csv to xls files. could someone tell me in the code below which line specifies the .csv file name that i need to change in order to …  |
| | every time i try to run my program (driver) is receive the following error message, arithmetic.pm did not return a true value at ./driver line 9, begin failed--compilation aborted at ./driver line 9 can anyone help me sort this out? thank you very much [CODE]#!/usr/bin/perl -w #Driver #program by James … |
| | Hello , the problem is this, i need to install the XML-LibXML library and it seems to be easier to put salt in your eyes than to realize this. I get the error below which basically states that i cannot install the library because i don't have libxml2 installed. Of … |
| | So, i need help to do couple of things: [B]1.[/B] To change the hyperlink into a button. The link downloads the file from the server, which is pointed in the database. Below is the actual code of the hyperlink, and what I tried to do, to change it to a … |
| | Hi All, I am trying to find matches wherever there is an ip address in the xsl and xml files under a parent directory(It contains subdirectories as well). In MS Dos below command doesnt work. Could anyone please give me the perl snippet to find the ip address matches? findstr … |
| | Hello, I have a question. I found a script on the Internet that lets people change from one language to another, in this case from English to French, but files must all reside in the same folder. The script works, however, my files are in seperate folders in the root, … |
| | Hi, If it's not too much trouble I would appreciate some help with this: How I can read one by ane all xml files in one directory and to have options to get same elemests from xml files :) For example: [CODE] chdir("/ras-events/Emanuila/edrs/") or die "Couldn't open directory"; opendir (DIR, … |
| | I have two computers, one a laptop with Windows Vista the other Mac Snow Leopard both receive the same mail when ever mail comes to my address. [U]Occasionally[/U] I receive mail from a friend arriving on the Vista computer it's fine. When it arrives in the Mac it has hyperlinks … |
| | Dear all, I need to copy a set of files every once in a while from my build env to a shared drive. The set of files are same, names may vary but they come with same extension. So far I am doing it manually. I wish it could be …  |
| | Im learning a new language , perl, and am wondering what are some useful perl systems admin scripts? What are some scripts sys admins write to automate tasks etc.. any ideas, id like to learn the usefulness other than perls ability for "quick and dirty" programs. thanks! |
| | hi.. i used this code to display a clock. [CODE]<script type="text/javascript"> var int=self.setInterval("clock()",1000); function clock() { var d=new Date(); var t=d.toLocaleTimeString(); document.getElementById("apDiv1").innerHTML=t; } </script>[/CODE] in firefox it displays like this 7:25:00 PM and in Chrome 19:25:39 i want to show a similar clock as in firefox in Chrome. How can … |
| | Hi, I made the perl script and I print out with Txt file. For EX : [CODE]Open (OUTPUT,">data.txt"));[/CODE] out put [CODE]data.txt[/CODE] But I hope at the day that I run the script, the day will be labeled with the name file. Like the name below: [CODE]20110919data.txt[/CODE] Could you please show … |
| | i have a script for greenstone applciation mkcol.pl here it is: [CODE]#!/usr/bin/perl -w ########################################################################### # # mkcol.pl -- # A component of the Greenstone digital library software # from the New Zealand Digital Library Project at the # University of Waikato, New Zealand. # # Copyright (C) 1999 New Zealand … |
| | Hi, I have the data file. txt (3.96 MB) and I want to make each 50 Character on the one line. For EX: In put data : [CODE]GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC........ [/CODE] [CODE] out put with 50 character on one line: GTGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCC TGAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCG GAGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGA AGCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGAT GCCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATC CCAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCT CAGAACTCATCTTCTTTGCTCGAAACCTGGCGCCAAGTTGTTGCCGATCTC [/CODE] Below is my script … |
| | Hi, I have a code (below) that reads from a file and output the file content a fter inserting a tab and & in-between different elements into another file. [CODE]my $REPORT_FILE = 'report.txt'; $allRfile = 'AllidentifiedMetabs1.txt'; open(ALL,"<AllidentifiedMetabs1.txt") || die "can't open $allRfile $!"; my $line = <ALL>; ($ID,$name,$M2, $M3, $M4, … |
| | Hi Everyone, Can anyone pls help me out......with my requirement, i am struggling since 3 days. Please find the requirement below my file contains below data Code: R1|Array/Network Resistor - VIP|V_RES_CLASS|V_MOUNT_FEATURE|SURFACE MOUNT|AND|8533.10.00.20|8533.10.00.20| R1|Array/Network Resistor - VIP|V_RES_NW_CLASS|V_TECHNOLOGY|CARBON*||8533.10.00.20|8533.10.00.20| R4|Array/Network Resistor - VIP|V_RES_CLASS|V_MOUNT_FEATURE|THROUGH HOLE MOUNT|AND|8533.10.00.57|8533.10.00.57| R4|Array/Network Resistor - VIP|V_RES_NW_CLASS|V_TECHNOLOGY|CARBON*||8533.10.00.57|8533.10.00.57| R7|Array/Network Resistor - VIP|V_RES_CLASS|V_MOUNT_FEATURE|SURFACE … |
| | Hello, I'd really like some help on this. How can I add the server's root folder of "english" to this: [B]~ s/_e\.shtml/_f\.shtml/ [/B] This searches all occurences of [B]_e.shtml[/B] and replaces them with [B]_f.shtml[/B] (it being in the same folder). Yet, in between that, I would like to add the … |
| | Hello, Please help me to do this. i take one combobox in modelpopop. but it is not working properly. textbox is Display properly but right side button not display. there is not problem in css. because i put same combobox in simple page. outside modelpopup. Please help me. Jack |
The End.