2,452 Topics
 | |
| | Hello i am new in perl scripting.I have to write a script to check for .c file and then go in to the ,c file and find all function and insert line1 after `{` and line2 before `}` or before return( if return is present). Can any1 plz help me …  |
| | Hi im new to perl..I normally code java...but the boss got me trying to fix this issue... Anyway,we get a news feed that comes in as an xml file...this feed now requires "basic HTTP authentication"...the old feed didint require this , so there was nothing implemented in the code, ...anyway … |
| | Hi I am a newbie to PHP. i am having serious problems trying to pass the id to the next page via a hyperlink. i am creating a real estate website and after searching for a property the code below is displayed. this code basically should list all the properties. …  |
 | I am very sure the code below can be simplified. The exercise was to take a word list, rearrange each word's letter to be in alpha order (e.g. barter = aberrt). The rearranged letter would be the keys and the word be be assigned to that key. Similar keys could … |
| | Hi guys, i need help extracting e-mail id from the text file can anybody please tell me how can i extract e-mail id and store it in a vaiable using perl regex. (e-mail id is not always bound to end with .com) here is my text file: ****************************************** IQXpert 27(ID) … |
| | have a bit of an issue trying to obtain some data from a csv file using PERL. I can sort the file and remove any duplicates leaving only 4 or 5 rows containing data. My problem is that the data contained in the original file contains a lot more columns … |
 | Can someone please tell me what's wrong with this? [code]my $time = "12/Jan/2008:13:38"; my ($day, $month, $year, $hour, $minute) = $time =~ /(\d+)\/(\w)\/(\d+)\:(\d+)\:(\d+)/;[/code] I've tried a hundred different things including not escaping the colons, putting parenthesis around ($time...[regex]), splitting up the assignments to $day = $1, $month = $2, etc... … |
| | Hello all I have been wrting a blast script which results in the following error: [code] the small rnas:CAGCGATGGGGATCAAGCTC the sequnce thats being worked is CAGCGATGGGGATCAAGCTC [blastall] WARNING: Unable to open TCV-jagger.fna.nin [blastall] WARNING: : Unable to open TCV-jagger.fna.nin ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: blastall call crashed: 256 /usr/bin/blastall -p … |
| | Hi All, Is there any one woh can help me about adding hyperlink column to a table or a grid view to an aspx page. I need it urgently :sad: thanks in advance. |
 | IE starts then a second or two later it stops working and a tool tip pop-up at the bottom says "To help protect your computer, Data Execution Prevention has closed Internet Explorer" What is this and how do I fix it? I use Firefox more but I still use IE … |
| | HI I am trying to print a certain number of sequences from a file. So if the sequence is like LKSAJDLSAJDLSAJDLKSJD. then I want to write from 10th character to 20th character. please help. Here is my code [CODE]#!/usr/bin/perl -w use strict; use warnings; my ($fileName, $firstSequence, $lastSequence) = @ARGV; … |
| | Hi I am trying to read two files and then copy their content to a third file while removing duplicates please help [CODE]#!/usr/bin/perl -w { open A,shift; foreach (<A>) {$a{$_}++}; open B,shift; foreach (<B>) {$b{$_}++}; open C,shift foreach(<C>) { print unless $a{$_} print unless $b{$_} } } [/CODE] |
| | I'm helping my dad out with some of his website issues, so any help is appreciated. He is getting an error (and no I don't have the exact text at the moment) that there was a fatal error in charlint.pl The problem apparently started when the site's host updated the … |
| | Hi Guys me again, still working on the ohiochirorelief.com site. problem i'm having now is I'm trying to add a footer that spans the width along the bottom. but it doesn't. the text and graphic just appear at the end of the right column instead of the bottom of the … |
| | #!/opt/bin/perl $[ = 1; # set array base to 1 $, = ' '; # set output field separator $\ = "\n"; # set output record separator $FS = ';'; line: while (<>) { chomp; # strip record separator @Fld = split(/[;\n]/, $_, 9999); $id = $Fld[1]; if ($. == … |
| | I want to be able to put two hyperlinks into a single gridview cell such as: hyperlink1 | hyperlink2 How do I accomplish this task? Thanks in advance for any and all assistance. Edit/Delete Message |
| | Hi All I need to add mouseover event on hyperlink which is in a gridview. What actually I need is displaying names of states in a gridview as hyperlink and when I take mouse over any state, it should navigate to a new page taking that stateid as querystring, So … |
| | Hey guys, I have a problem. When I try to run a program that I've compiled with VS 2005 on a different machine that does not have VS, I get this error. "The application failed to initialize properly (0x0150002). Click on OK to terminate the application." I've installed the Microsoft …  |
| | I'm showing a directory listing in one page now, but I want to show it in pages. Currently I'm working like this: [QUOTE]gtsee.com/cgi-bin/nph-dirsub.pl?invoice=invoices/merchant_invoice_999999 [/QUOTE] and the script for showing the listings are: my $sql=SELECT id, name, url FROM free_dirs; my ( $id, $name, $url) = @{$db_row}{qw/id name url}; print " … |
| | Hi All, could you please help : i have a script to search the for PRIMARY INDEX and if found display the whole definition of create table: ISSUE NOW IS: we have to store the table name in a variable and search the file if any update,show table exists for … |
| | Hello All, I am trying to figure out how to write user input into a text file. I created a text box that the user can type his/her name into. I am trying to get the information from that text box to be written to the text file using print … |
| | Hi, How do I test Perl scripts in a web browser on a mac? Im using OSX 10.4.11. Ive got some documentation on how to edit the /etc/httpd/httpd.conf file, but its read only for some reason (even though Im on my own laptop). I also run MAMP and thought that … |
| | Hello All, I am trying to use an image as a background. I am working with perl through putty .58 and am wondering how to get an image into a specific location in putty that can be used in a perl webpage? Thanks, |
| | I have this script which uses the Net::FTP module to copy some files to some remote machine.It works fine with every file but a xml file.My application requires that the timestamp of the xml file doesn't change but the ftp script changes it.Is there any way around it? |
| | Hi guys, I'm writing a simple script that uses snmpget statements to check the errors received by ports on a router and have the results going to a file. I've never worked with Perl before but one of my coworkers had a really basic script that I've been trying to … |
| | I have a PS/2 laser mouse. I have it set at the lowest possible double-click rate there is. But it still clicks 3 times to my one tap. I don't know whats going on with it. But anytime i try to click something it either highlights it or makes me …  |
 | I've recently been elevated in my team to a lead position, and one thing I have identified as a problem is that we don't have any existing curriculum or program for teaching programming to those members on our team without programming experience. There seems to be a barrier to people's … |
| | I'm experimenting with fgets because I heard it's better for dealing with memory buffer overflow but I am not sure of the [B]sizeof[/B] component and how to the [B]stdin[/B] part helps it to work. Is [B]METHOD 1[/B] or [B]METHOD 2[/B] in the following code the correct implementation of [B]sizeof [/B]and … |
| | hi, I was exercising package creation and its usage in Perl. I started with a simple program, 1. Created a package called A 2. Created a package called B 3. A program which includes those packages, and uses its services. [code=Perl] # A.pm package A; use warnings; my $l_var = … |
| | I am trying to move files and rename them with a date-time stamp I generate. I have a survey and my perl script processes the POST query string. Once I have the query string, I am using XML::Simple to get the stored results, update them, then write them back out. … |
The End.