49,757 Topics
 | |
| | int main( int argc, char *argv[] ) { ==> This function has over 60 lines. You need to split it into smaller functions Everytime I try to split it up I just cause errors (it compiles but locks up when I run it through the test system so I think … |
| | Hey, it looks like I'm stuck yet again. I've been working on this for awhile and I can't figure out why it's not working properly. Here's what I'm supposed to do: Create a function that simulates coin tossing. The function should have no input and no return value. When the … |
 | Hey I'm working on this program that tests you on a few questions. I enter the answer to one and it comes back and displays correct. For some reason though when the next question comes on it already comes back with a response saying the answer was incorrect. Here's the … |
| | hey I have been looking up shapes in c++ but everyone talks about needing certain compilers and #includes but i don't have those compilers i have just been using the standard Microsoft visual studio at my school i think and my teacher has just asked us to create different shapes. …  |
| | Hello I need some help with this question. I have attempted to write a segment of code for the Binary Search Trees in C++ code. Refer to the question below. Design and implement a program in C++ to solve the following problem. DESCRIPTION This program, which learns by asking questions, … |
 | I'm continuing my project and found a strange error, I can think of ten thousand hacks to get around it and a few ways to fix it properly, but my curiousity is peeked. why Is AStringBufEx end result 18 characters long when the Lenth of the initial string is only … |
| | i am doing a project with visual c++ .In my project I have 2 forms . I want to do some calculation of some data of the form Form1, and i want the result of this calculation to write to a label of Form2. How to do this? |
| | Can anyone lease tell me the value of k? I know it starts at 0 and loops backwards but I can't figure out where it terminates. I would really appreciate someone telling me the best way to figure this out so I can solve these problems in the future [code] …  |
| | I do not understand what I am doing wrong... I need the second triangle to print the character the user inputs, but instead - and I have no clue as to why it is doing this - it prints the second triangle with smiley faces and other symbols. Any help …  |
| | #include <cstdlib> #include <iostream> #include <fstream> #include <iomanip> using namespace std; struct Item { string name; int quantity; double unitPrice; string description; }; struct ItemTotal { string name; int quantity; double unitPrice; string description; }; void sort(Item list[], int n) { for(int i=0;i<n;i++) { for(int j=0;j<n-i-1;j++) if (list[j].description<list[j+1].description) swap(list[j],list[j+1]); } … |
| | Today I had this question in my exam: [CODE]write a program in C++ that covers the next points: -a company needs to enter its employees' data into the computer -each emplyee has (ID-Job Code-Division Code-Salary) -should be done using struct -Input/Output functions should be inside the struct -use the struct … |
| | Hi, I have a problem with the tolower function. I use Netbeans 6.5 with GCC C++ on Ubuntu 64bit. The problem is, that I use nordic letters like å, ä and ö and the tolower function does not affect them at all. I have tried almost everything. I have tried … |
| | Hi guys, new to the forum so i hope that my first topic wont be full of errors. Anyway, i just started programing a couple of weeks ago in a program at my elementary school, and i have a couple of Q's. so this is my prog. [CODE] if(ima == … |
| | Hi all, I am using Visual Studio 2005, and developing some application. Currently i am facing one problem. I have written a class and declared some member variables in the class. In the constructor i am initializing the member variables to 0(member variable is int). But when i debugged the …  |
| | [i](Im using VS C++ EE 2008)[/i] Hi people, i have had a strange problem today. Im currently programming something to do with Physics. I have searched the Internet already for the answer, including this site. The problem is: [i]error C2064: term does not evaluate to a function taking 1 arguments[/i] … |
| | hi guys.. i'm doing this program.. haven't finished it yet.. i'm not getting any errors but the program is not running correctly.. I dunnu y,, i did everything i had to and it says 1 succeeded with no warnings ! here is my code.. [CODE]#include <iostream> #include <fstream> #include <cstdlib> … |
| | I have a text file with something like this in it: >ENSG00321 Gene_ch19 . . . . AATAGCGGTTAACATATTAATTAAACTAATGTATAGATATTATCCGCTTCCAGATTTATTATTTTGTAAA ATAGGCACAGTTCTTATCTGGTGTCACTTTATGCTTTTTTAATAGACGCCCAGCTCTACTCATGGCCAAG . . >ENSG00531 Gene_ch5 . . . . AAAGAAGCGTAGGCCCGCCATGCAGCGTAAAAAGGATAATGCGGAGCAGCGGTCCCCAAAGACTGATTTA TCAAAACTGTTTTCGCAGCAATTAACACACCCACCGACCAGTAACACCGCTGCAAGCAAGGCCACGGGCA . . I have some headers like (ENSG00321) too. I want to search in text files with header and then get … |
| | Hi, I want to create a sequence of vector<double> each with a name + a number that goes from say 0 to 9. For example, how do I make a loop that creates10 vector<double> that goes by the name : vector_0, vector_1, ..., vector_9 ? Thanks.  |
| | This is the hex output from a LARGE_INTEGER. "EA 00 0B 00 A1 00 00 00" On my machine a DWORD is read "00 0B 00 EA" How do you place the high 32 bits in the sequence? This leads me to the question of how to output this to … |
| | i have a following code: [code=cplusplus] #include <vector> using namespace std; class A { int t; int f; public: A(){}; }; class B { vector <A> a(10); int y; public: B(){}; }; int main(int a, char *b[]) { B c; } [/code] when I try to compile Iam getting the … |
| | my code so far...... [code=cplusplus] // ProjectDevelopment.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include <iostream> // This libary allows standard input and output operations. #include <string> // strings are used as tempory storage - for the input to a text based file #include <vector> … |
| | hi guys, hopefully somebody can tell me what i'm doing wrong here: i'm trying to put together a copy constructor with this linked list class, but i just cannot get it to compile: [code] #ifndef LINKEDLIST_H #define LINKEDLIST_H //*************Include Statements************* using namespace std; // for cout //***********END Include Statements*********** class … |
| | Hi there, I have not looked at C++ code for 7 years and so need a bit of help with this. I basically need to have a dll installed on a client machine. This dll will be called from another program. The dll will need to open a customed browser …  |
| | Hi I am new to C++ and I'm trying to create a console program that quizzes you using some of my old quizzes. My only problem is when I get to questions where there are spaces between the word it messes up. Here's an example: string answer1 = "anything\0that\0has\0mass\0and\0occupies\0space"; string … |
| | i want to print the double base representation of a number ie if my number is 38 i shud get 36 + 2 and for 655 i shud get 648 + 6 + 1. here's my code: [CODE] unsigned long bs(unsigned long a[],unsigned long d, unsigned long beg, unsigned long … |
| | Hello., I'm very new in C++, and I have a task to solve. I have a function: [CODE] void cio_display(const char *str, int row, int col, int len){ int i; cio_move(row, col); if(len<=0) { cio_putstr(str); } else{ for(i=0;i<len && str[i];i++) cio_putch(str[i]); for(;i<len;i++) cio_putch(' '); } [/CODE] here iss what i … |
| | Ok what i'm trying to do in this program is first create an empty binary file of size 31 records. Records includes studid & gpa. and then I insert valid record into the binary file with h(k) = key% 29..and then read this binary file sequentially and write the records … |
 | Hey guys, Below code isn't working as I expect it to do. I expect it to read all params when 6 are given, buuuuuuuuuuuut it only reads one, the rest remains zero. It does enter the case, but the stringstream buf seems empty. What am I doing wrong? [code=cpp] #include … |
| | Is it possible to print anything on screen in C or C++ without using main().If yes please explain how?  |
| | how do i output solution in array form into a file where it can then be copied. |
The End.