49,766 Topics
![]() | |
Hello, I'm writing a MFC application to move a picture control when i press the "Next" button. (Please see attached screen-captures) There is a dialog box on which there are 2 picture controls. When I press the Next button, the left picture control should move on top of the right … | |
Hello, I require a help on a basic issue. I have 2 classes and I want to have an interaction among the classes. Suppose my 2 classes are testA and testB. Now I want a handle of object pointer in each class to the other class. Like I want a … | |
Hi to all I have ADT of the AVL TREE and I need to add some the function to create tree to family. I have logic error in my code.. my code work to find relationship between two nodes (e.g: a parent of b,a and b are Sibling and so … | |
I hate to be spamming the forums with this, but I've been banging my head at the wall for a few hours now, and I can't really understand what is going on. Here's the full program I'm running: [code=c++] #include <iostream> #include "math.h" int main() { std::cout << sin (3.141592653589793) … | |
Alright, so I am very new to c++ and I just felt like doing a little encryption experiment. In about ten seconds of thinking I've decided that for my encryption I want to: Get the ASCII value of a string of text entered by the user, and store it in … | |
Hey guys, I am having issues understanding how exactly to mod something to avoid overflow. say i have this hash function: [CODE=c++] int universalHash(const string &x,int B) { long long sum; long long power; sum=0; pow = 1; for (int i=0;i<(signed)x.length();i++) { // cout << "sum= " << sum << … | |
Hi, I am also facing problems in converting a file.txt to a file.bin. Cheers, Dagiwal | |
hi , can anyone tell how to define AND operator by regular expression. Actually I want to return match if and only if 2 substrings will appear in string. For example i have string "[B]Successful Logon: User Name: Administrator Domain: Logon ID: (0x0,0x154CB759) Logon Type:2 Logon Process: Advapi Authentication Package: … | |
i am new to c++ programing.can anyone tell me how to draw a line from a point to another point. if the coordinates of the points are given.in (x,y) please also tell me the header files which should be included in program. your comments will be highly appreciated. | |
int main( int argc, char *argv[] ) { ==> This function has over 60 lines. You need to split it into smaller functions Everytime I try to split it up I just cause errors (it compiles but locks up when I run it through the test system so I think … | |
Hey, it looks like I'm stuck yet again. I've been working on this for awhile and I can't figure out why it's not working properly. Here's what I'm supposed to do: Create a function that simulates coin tossing. The function should have no input and no return value. When the … | |
Hey I'm working on this program that tests you on a few questions. I enter the answer to one and it comes back and displays correct. For some reason though when the next question comes on it already comes back with a response saying the answer was incorrect. Here's the … | |
hey I have been looking up shapes in c++ but everyone talks about needing certain compilers and #includes but i don't have those compilers i have just been using the standard Microsoft visual studio at my school i think and my teacher has just asked us to create different shapes. … | |
Hello I need some help with this question. I have attempted to write a segment of code for the Binary Search Trees in C++ code. Refer to the question below. Design and implement a program in C++ to solve the following problem. DESCRIPTION This program, which learns by asking questions, … | |
I'm continuing my project and found a strange error, I can think of ten thousand hacks to get around it and a few ways to fix it properly, but my curiousity is peeked. why Is AStringBufEx end result 18 characters long when the Lenth of the initial string is only … | |
i am doing a project with visual c++ .In my project I have 2 forms . I want to do some calculation of some data of the form Form1, and i want the result of this calculation to write to a label of Form2. How to do this? | |
Can anyone lease tell me the value of k? I know it starts at 0 and loops backwards but I can't figure out where it terminates. I would really appreciate someone telling me the best way to figure this out so I can solve these problems in the future [code] … | |
I do not understand what I am doing wrong... I need the second triangle to print the character the user inputs, but instead - and I have no clue as to why it is doing this - it prints the second triangle with smiley faces and other symbols. Any help … | |
#include <cstdlib> #include <iostream> #include <fstream> #include <iomanip> using namespace std; struct Item { string name; int quantity; double unitPrice; string description; }; struct ItemTotal { string name; int quantity; double unitPrice; string description; }; void sort(Item list[], int n) { for(int i=0;i<n;i++) { for(int j=0;j<n-i-1;j++) if (list[j].description<list[j+1].description) swap(list[j],list[j+1]); } … | |
Today I had this question in my exam: [CODE]write a program in C++ that covers the next points: -a company needs to enter its employees' data into the computer -each emplyee has (ID-Job Code-Division Code-Salary) -should be done using struct -Input/Output functions should be inside the struct -use the struct … | |
Hi, I have a problem with the tolower function. I use Netbeans 6.5 with GCC C++ on Ubuntu 64bit. The problem is, that I use nordic letters like Ã¥, ä and ö and the tolower function does not affect them at all. I have tried almost everything. I have tried … | |
Hi guys, new to the forum so i hope that my first topic wont be full of errors. Anyway, i just started programing a couple of weeks ago in a program at my elementary school, and i have a couple of Q's. so this is my prog. [CODE] if(ima == … | |
Hi all, I am using Visual Studio 2005, and developing some application. Currently i am facing one problem. I have written a class and declared some member variables in the class. In the constructor i am initializing the member variables to 0(member variable is int). But when i debugged the … | |
[i](Im using VS C++ EE 2008)[/i] Hi people, i have had a strange problem today. Im currently programming something to do with Physics. I have searched the Internet already for the answer, including this site. The problem is: [i]error C2064: term does not evaluate to a function taking 1 arguments[/i] … | |
hi guys.. i'm doing this program.. haven't finished it yet.. i'm not getting any errors but the program is not running correctly.. I dunnu y,, i did everything i had to and it says 1 succeeded with no warnings ! here is my code.. [CODE]#include <iostream> #include <fstream> #include <cstdlib> … | |
I have a text file with something like this in it: >ENSG00321 Gene_ch19 . . . . AATAGCGGTTAACATATTAATTAAACTAATGTATAGATATTATCCGCTTCCAGATTTATTATTTTGTAAA ATAGGCACAGTTCTTATCTGGTGTCACTTTATGCTTTTTTAATAGACGCCCAGCTCTACTCATGGCCAAG . . >ENSG00531 Gene_ch5 . . . . AAAGAAGCGTAGGCCCGCCATGCAGCGTAAAAAGGATAATGCGGAGCAGCGGTCCCCAAAGACTGATTTA TCAAAACTGTTTTCGCAGCAATTAACACACCCACCGACCAGTAACACCGCTGCAAGCAAGGCCACGGGCA . . I have some headers like (ENSG00321) too. I want to search in text files with header and then get … | |
Hi, I want to create a sequence of vector<double> each with a name + a number that goes from say 0 to 9. For example, how do I make a loop that creates10 vector<double> that goes by the name : vector_0, vector_1, ..., vector_9 ? Thanks. | |
This is the hex output from a LARGE_INTEGER. "EA 00 0B 00 A1 00 00 00" On my machine a DWORD is read "00 0B 00 EA" How do you place the high 32 bits in the sequence? This leads me to the question of how to output this to … | |
i have a following code: [code=cplusplus] #include <vector> using namespace std; class A { int t; int f; public: A(){}; }; class B { vector <A> a(10); int y; public: B(){}; }; int main(int a, char *b[]) { B c; } [/code] when I try to compile Iam getting the … | |
my code so far...... [code=cplusplus] // ProjectDevelopment.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include <iostream> // This libary allows standard input and output operations. #include <string> // strings are used as tempory storage - for the input to a text based file #include <vector> … |
The End.