2,452 Topics
 | |
 | Dear Sirs, Can you please check this code and comment what should be the proper one. <label for="username">Username:</label> <br /> <input id="username" type="text" value="ENTER USERNAME" onclick="this.value='';" name="username"/> </p> <p> <label for="password">Password:</label> <br /> <input id="password" type="password" value="ENTER YOUR PASSWORD" onclick="this.value='';" name="password" /> here is the link for this one... http://insanitygzonecom.ipage.com/clubfive/login.php  |
| | I am using the following code on my raspberry pi (with debian as the os), and when i run it, it says: cannot load image C:/root/desktop/Snake.bmp * Traceback (most recent call last): File "/root/game.py", line 25, in <module> background, tmp_rect = load_image('Snake.bmp') File "/root/game.py", line 11, in load_image raise SystemExit, … |
| | <asp:HyperLink ID="Link1" runat="server" Text="Record an activity" NavigateUrl="~/ActivityRecord.aspx"> </asp:HyperLink> </div> <div> <asp:HyperLink ID="Link2" runat="server" Text="Add information" NavigateUrl="~/Information.aspx"> </asp:HyperLink> This is the code I have and I have the pages ActivityRecord and Information but it's not working. When I click either of the links it just reloads the home page I am …  |
| | To start, it is NOT a hacking job. I want to access my USAGE report from my ISP. At the home page I have to select Account Management then login with my user name and pw from newly created prompt. One clicking login I get yet another prompt so I … |
| | I am trying to create a survey that displays only one question at a time. i have gotten it to show and store the question, but i cannot get to the next question in the survey. i know that once i get to the next question in the survey i … |
| | I have a directory of log files - audit_20121101_010000.csv (nov 1st), audit_20121102_010000.csv (nov 2nd), audit_20121103_010000.csv (nov 3rd), audit_20121104_010000.csv (nov 4th) etc. generated on a daily basis (windows box). I am very new to perl and would like to compare the most recent file with the second most recent file on … |
| | **Lay of the Land** I have been tasked with rewriting a website, (I'm new to the ways of PHP). This website is a way for users to transfer files, usually between 10 MB - 1 GB using HTTPS; which includes a coupling to a broad single-sign on service. Half the … |
| | print "enter a number: "; $in = <>; chomp $in; print &prime($in); print "\n"; sub prime{ for($i=2;$i<($_[0]/2+1);$i++){ if($_[0]%$i ==0){return "not prime\n"} } return "prime\n"; } can anyonet tell me, what program do i use to make this code work?.. i just found it on the internet while searching a formula … |
| | So basically I'm using a gridview to display information & the user will select one option from the table, when they do It should bring them to the page that is for their option. However at the minute all I've got it doing is no matter what option you select … |
| | hello, Im new to PERL and I'm writing some code to compare two files lines: file 1 gets random password from a server file 2 is a test case to check that I'm getting the password with the required characteristics ( length, alnum or num) the problem that I have …  |
| | AH 1106 AH 11989 AH 121 BH 120 BH 220 CH 330 I want result like AH 1160 11989 121 BH 120 220 CH 330 |
| | So i was wondering if it is possible to make something <a class='photo' href=<?PHP 'lala.php?blu=$q&subf=$subf&img=$imagenr' ?> target='_blank'> <span><img src=<?PHP'{$handle}/{$file}'?> /></span></a> lala.php is already made with all needed, but when i'm trying to make something with this code it doesnt show up the photo. I named class photo so i can … |
| | Hi, I have 2 files. I need to read a line from the File 1 and check for it in File 2. If it is present, I need to delete that line from File 2. File 1 A1 B1 C1 File 2 A1 ABCDEF S1 EEE C1 EFGH D1 XYQ … |
| | Hi all, Requirement: - I have a perl script that I need to run for several hours, for a performance test. - I would like to create a second script in ANSI C to call the perl script. The C script should be able to parse any of the text … |
| | so i was trying to make a binary tree program. just inserting and deleteing. some how i messed up. i think insertion is ok till level 1 after that stays on level 1 only. also the function to delete the whole tree is not working. it only deletes node at … |
| | **I develop a simple asp.net application.My grid has autogenerate columns,i want to pass my last cell value in grid to hyperlink** |
 | I have a text file containing contents like 1 A 0 -1 -2 -3 -4 2 A -1 2 3 -4 -5 So I read the file and used split function as @a=split(/ /,$_) and took each line into array a. But now when I take these into array a … |
| | Hi, I have a sytem path like "C:\Users\ABC\XYZ\1.txt". I need to convert this to 'C:\Users\ABC\XYZ\1.txt'. Any help is appretiated. Thank you. |
| | I have a Seagate 500GB external hard drive that has been put in a new casing after some wires in the original came loose. I only got it back two days ago. So today I plugged it into my macbook and everything was fine, and then suddenly the warning/error window … |
 | Hi, let say that i have this excel file that contains column of account number and the name of the customer. And I want to extract any of the data that have duplicate. And the script should be able to get the duplicate only if the both of the account … |
| | Hello; While this script working, in case of not to connect a node ("BADYK01","BAGRK01", "BAHLK01", "BAHLK02", "BAHLK03") , it stops. I want it to be continue even if it doesnt connect a node. I mean if it couldnt connect to BAGRK01, I want it to be continue and connect the … |
| | #!/usr/bin/perl -w use Win32::OLE qw(in with); use Win32::OLE::Const 'Microsoft Excel'; $Win32::OLE::Warn = 3; # die on errors... # get already active Excel application or open new my $Excel = Win32::OLE->GetActiveObject('Excel.Application') || Win32::OLE->new('Excel.Application', 'Quit'); # get a new workbook $book = $ex->Workbooks->Open('C:\Users\Andrew Babitt\Documents\ProductClonesTest.xls'); $Obook = $ex->Workbooks->Open('C:\Users\Andrew Babitt\Documents\NSS\extract_Products.xls'); my $billschedule = $Obook->clumn(B)->{value}; … |
| | Hi. I am currently in a position where I am having to learn Perl in the context of developing a website using Embperl. I am at a point where I have a few subroutines that I would like to try off-loading to a separate file and then including that file … |
| | When I try open links in outlook i get the following error message - 'Contact your system administrator due to restrictions in effect on my computer' This is a Windows 7 pc running outlook 2010 and using an Exchange 2010 mailbox. any ideas? Thanks |
| | hi, when i try to multiply the double value with 100, i got inconsistent o/ps.. here the codes... Case1:- double d=15.025d; System.out.println("d="+(d*100)); o/p:-d=1502.5 Case 2:- double d=16.025d; System.out.println("d="+(d*100)); o/p:- d=1602.4999999999998 and this issue to 17.025,18.025,19.025 & 20.025 also. it suppose to be d=1602.5 right? why these particular o/p and how …  |
 | Not sure if this can be done. There are word files in a directory with all familiar names. i.e. fr001, fr002, fr003, etc... all with the extension .doc. I would like to know is there a code that will link an excel file to a directory and then be able … |
| | Hi, Anyone here know how to compare the old array data from database with the new array data also from the same databse? Please help me. Its urgent.. :( |
| | Im trying to get my program to look like the following Welcome to the 64th Primetime Emmy Awards! ============================================================================== The nominees for Outstanding Comedy Series are: [1] Write In [2] The Big Bang Theory, CBS [3] Curb Your Enthusiasm, HBO [4] Girls, HBO [5] 30 Rock, NBC [6] Veep, HBO … |
| | Hey Guys So in my work, I create an excel spreadsheet. The spreadsheet has cells with hyperlinks in them. When clicked on, the user is taken to another cell within the spreadsheet. Sort of like an anchor. So I was reading on the web that there are no free PDF … |
 | Hello hi. I am seeing flames with using FILESTREAM in SQL Server 2008! I have a table (Products), in which I wanna store a link to an image stored on disk, under the ProdPicture column. This is what the script looks like: CREATE TABLE PRODUCTS ( ProdID INT PRIMARY KEY, …  |
| | I have installed Qt on my ubuntu laptop and I get nothing but errors compiling .cpp files with <QApplication> preprocessor directives. I am new to using Qt and are reading a book online about it hosted here: http://www.informit.com/articles/article.aspx?p=1405562 Specific error i have obtained running g++ hello.cpp -o hello: hello.cpp:1:24: fatal …  |
| | Hi, I have a file containing multiple-headed data (input file 1), and also a second file containing elements for searching the first file. input file 1: UROPA sseD 1.2.3.3.3 crimson ddsU 2.1.4.1.2 green SAMEL aadH 7.4.1.1.1 blue uuoG 10.1.2.3.4 white MOONA gmaL 3.4.1.6.7 red oolJ 9.1.1.4.1 yellow input file 2: … |
| | Hi, I need to search a particular string in a CSV file ("STPSTR01.134") the line that contains this string. I need to divide the 13th column by the 14th column. Any help would be very much appreciated. I'm using ActivePerl for windows /csv file allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.134;900;FALSE;SCANNER;10;3471;6288;11093;10419;588480;631296;0;254004;316732;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.58;900;FALSE;SCANNER;10;20652;23514;39497;29404;4690132;3929776;0;3471992;2947904;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.60;900;FALSE;SCANNER;10;20593;19351;36274;26039;4350820;3462084;0;3234956;2593056;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.62;900;FALSE;SCANNER;10;24237;21229;40003;28678;5122408;3703840;0;3875508;2746088;0 allAssociationUtilizationData;V16SG;2012/07/27;10:45:00;STPSTR01.26;900;FALSE;SCANNER;10;18538;20644;35833;26421;4075280;3588768;0;2979124;2707892;0 |
| | Hi, I've got a set of folders with each contain many files. I need to extract a specific file extention(.sof) from each of these folders to a new directory(or the same directory in a new folder). Any help is appreciated. Thanks. |
 | I am going to work on building a database application. One part of this is parsing pdf files which will feed the data into the database. Will be using SQLite build it C which has wrappers for Perl so there's not problem there. From what I understand, Perl is a … |
 | I am trying to send sms through Way2sms using Perl LWP. The login part is being successful, after which I save the cookies to a local file. The welcome page after being logged in shows a Send SMS link, clicking on which one is redirected to another page with two … |
| | I need help in using a variable passed in a hyperlink query string to do PHP query of a MySQL database. I want use the variable to query the database and return the unique row field data to display in a table The hyperlink is: [CODE]http://www.site.com/bios.php?pc=ab [/CODE] After connecting to … |
| | I am trying to write a script to grab images from my CCD camera. I can already do this with C++ usung VFW and OpenGL, but I want to find a way to do it with Perl. It needs to be able to run on windows though. I am pretty … |
| | I am having two file (File A and File B) of sequence. In File A, thousand of sequences are in fasta format (For example:>seq1 GGTGTTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAGA CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA >seq2 CTCATTAAATTGGCAAGAGGTGTTTGCGTGGTTTTGGCAAGAGGTGTTTGCGGGTTTTAAA TTTGCGTGGTTTCATGAAGGTTTTACTaTCCCGAGGAGCCTCATTAAATTGGCAAAAAAAA In File B, Two differnt things are avilable first is the sequence number i.e. >seq1 and its position number 10-120 similarly … |
 | Hi Daniweb, I've been using perl for Regex recently and I want to know is it possible to create an Excel Movie Library with the movie poster, the name of that file and a hyperlink of that clip is attached to the poster. Any help is appreciated. thanks. |
| | Hello I am trying to run a perl script on tomcat server. I am putting the incoming http request in a variable data which collects the headers as well as the text file attachment data. The code is like this : .... while(<>){ $data = $data . $_ ; } … |
 | I've attached my output error and my script is below, also the link the the directions. http://www.linuxfromscratch.org/lfs/view/stable/chapter05/perl.html Here's my script: ( patch -Np1 -i ../../../perl-5.14.2-libc-1.patch 2>&2 | tee patch-perl.log && exit $PIPESTATUS ) && sh Configure -des -Dprefix=/tools && cp -v perl cpan/podlators/pod2man /tools/bin && mkdir -pv /tools/lib/perl5/5.14.2 && cp … |
| | Hi, I am trying to search for a line in a file, comment that line using a " * " and finally append the range of corresponding lines extracted from the same file. The corresponding extracted range of lines maybe present before or after the line (which is to be … |
| | Hi, Can anyone help me in calculating the number of day between two date with this date format, YYYY-MM-DD? I am using Date::Calc qw(Add_Delta_days) but still cannot read. I got this error : -> <?xml version="1.0" encoding="UTF-8"?><soap:Envelope xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:soapenc="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" soap:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/" xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/"><soap:Body><soap:Fault><faultcode>soap:Server</faultcode><faultstring>Usage: Date::Calc::Add_Delta_Days(year, month, day, Dd) at TARGETWEBSVC.pm line 357. … |
| | that well known ajax code to filter gridview with text box control on key up event is working fine in fire fox but works only twice and then stops in internet explorer; if i take the grid out of the update panel it works fine on iexplorer also! any idea? |
| | hello all, i have a website like forum not exactly forum but similar. honestly, i bought it cos i didnt have any idea for php. but something about linking is not as i want. for example: when i link some webpage it shows the link [Click Here](http://www.aaa.com) but i want … |
| | Hi Everyone, I need a perl script to create a word document in linux (in my system i have openoffice(oowriter) 1.1.5) with some text as header(left aligned) which is taken from a "file.txt". contents of the file.txt are HariKrishna 1200 Srikanth 1201 Madhav 2345 So based upon the no of … |
| | Hi, I'd like to create a perl script that takes two input files, one being a master list of users/attributes, the other being a newly uploaded list. I'd like two output files, one being a file with new users (not in the master list) as well as updated users (changed … |
| | Hi, suppose I have written a Perl script that creates a text file, writes something to it, and closes it. The code involves some other steps which require the download of a module from CPAN. So I do this prior to executing the code by doing something like **perl -MCPAN … |
| | #!\strawberry\perl\bin print"Enter the number of column\n"; $r=<stdin>; print"\nEnter the numer of row\n"; $c=<stdin>; print"\neNTER THE sEQUENCE FOR THE ROW\n"; $i=0; for($j=1;$j<=$c;$j++) { $a[$i][$j]=<stdin>; } print"\neNTER THE sEQUENCE FOR THE ROW\n"; $j=0; for($i=1;$i<=$r;$i++) { $a[$i][$j]=<stdin>; } $i=0; { for($j=0;$j<=$c;$j++) { chomp $a[$i][$j]; print"\t$a[$i][$j]"; } print"\n"; } for($i=1;$i<=$r;$i++) { $j=0; { chomp … |
The End.