2,452 Topics
 | |
| | I'm new to perl and I'm writing a script to parse multiple Gaussian03 output files and extract certain pieces of data from them. Ideally the script needs to print out the name of each file, look for (the last) SCF Energy, the Zero-point Energy and check if the job has … |
| | HI, In a recent Google posts, now their will be a hyper link in the snippets of the website in Google SERP pages. Any ideas about it ? |
| | there are so many here: search.cpan.org/search?query=upload&mode=module which one do you use? |
| | Hello :-)! I installed Ubuntu in order to install CMU Sphinx ([url]http://www.speech.cs.cmu.edu/sphinx/tutorial.html[/url]). There is one problem with executing perl script and I think it is good place to ask for help. Script make_feats.pl is here [url]http://www.linuxforums.org/forum/attachments/debian-linux-help/2267d1256986736-kde-startx-debian-make_feats.pl.txt[/url] . When I run "perl scripts_pl/make_feats.pl -ctl etc/an4_train.fileids" I see "Configuration (e.g. etc/sphinx_train.cfg) not … |
| | Hi everyone Well I have been trying to install some modules like Bundle::DBI, DBD ::mysql and latex::Parser on my apple comp running mac OS X operating system. Every time I am trying to install a module I get an error like this : make had returned bad status, install seems … |
| | basically i am trying to search for similar strings in an array which is hardcoded into the script and compare them to and find the line they exist on the text file here is my code so far [CODE=perl] #!/usr/bin/perl %fruit=(banana=>1,apple=>2,orange=>5); $target = %fruit; open(INPUT, "<fruits.txt"); while (<INPUT>) { if …  |
 | I'm focusing now on this I/O thing, even writing a guide by looking some sources. I want to cover it all i can about stdin i/o and if it looks good in the end i'd love to share with you. But that's still OT. I can't get rid of the … |
| | Hi, I have strings like this: [code] $string="OWN - NLM STAT- Publisher DA - 20091005 AU - Gannon AM AU - Turner EC AU - Reid HM AU - Kinsella BT AU- XYZ AD - UCD School of Biomolecular and Biomedical Sciences"; [/code] I want to parse these tags and … |
| | Hallo everyone im starting to learn perl and i have a problem , i have an exercise asking me to count all the letters each apart in a DNA string , for example my @DNA =( ctagctagcatgacgatacatgacagataggatacagatagacagatacagatacagatacagatagacccatgacagatac) so i have to make a perl script showing the user how many … |
| | Hi all, I am a perl newbie. I am using a perl code to read a column full of data from 1 field into an array [CODE]for(my $i=2;$i<table->last_record;$i++) my @data = $table->get_record($i,"Date"); [/CODE] Now for example if my @data[1] consists of list of numbers, I need to find the diff … |
| | I had another thread before this one, but I felt that it was getting too long. Current problem: My operator== is not working properly in my program. I have done some things in my function, but I don't think it is "completely right". My program compiles fine and the output … |
| | Hello friends , I need to parse some data from a file and arrange it in a certain file..however the file is so confusing and has such minute issues that it has really confused me now..can sumbody help. Thanks Aj I am attaching the main part of the input file … |
| | I have the script updating everything else in my table with no issues at all, but when I go to update the image it never updates the image, but replaces the current image with the image that is only supposed to show if there is no image uploaded to begin … |
| | Hi I need some help to get this done using php: 1 - I have few hyperlinks say 500 in format like: [code=html]<a href="http://domaina.com/1.html" target="_blank">http://domaina.com/1.html</a> <a href="http://domainb.com/1.html" target="_blank">http://domainb.com/1.html</a> <a href="http://domainc.com/21.html" target="_blank">http://domainc.com/21.html</a> <a href="http://domaind.com/new.php" target="_blank">http://domaind.com/new.php</a>[/code] etc etc Now I want to convert them into format like: [code=html]<a href="http://domaina.com/1.html" target="_blank">keyword 1</a> <a … |
| | I have created the code to connect to a MySQL database and retrieve the values of a table. This is the function for printing the table: [CODE] # Name: dbHistory # Purpose: prints srvHistory table from database # Parameters: N/A # Returns: N/A # This is the implementation of the … |
 | I'm trying to bypass a script if possible to use only a hyperlink that i can build from a database to pull up a web page. What I have is addresses that I need to open in this website: [url]http://gisims2.miamidade.gov/myhome/propmap.asp[/url] You'll notice on the left hand side of the page … |
| | Hi, I have to develop a software and it should run on windows, mac and linux, so i was thinking of developing it in java using netbeans :-/ I have windows OS, would the jar file generated in windows run properly on mac and linux? and is there any specific … |
| | Hi, This is my perl program.......... [CODE]#!c:/perl/bin/perl use CGI qw(:all); $pfaccode=param('faccode'); $pprogramme=param('programme'); $pdeptcode=param('deptcode'); $pbrancode=param('brancode'); $psemester=param('semester'); $pkook = cookie(-name=>'logtime'); print "Content-type: text/html\n\n"; print "<body bgcolor=\"#ffcccc\">"; use DBI; my $dbh = DBI->connect("DBI:ODBC:wwwdsn","webid","dibew") or die "Cant connect: $DBI::errstr\n"; my $sth = $dbh->prepare("select kid from facltmst where faccode = ?") or die "Can not … |
| | [B]This is css code[/B] [code=css]*{ padding:0px; margin:0px;font-size:100% } html{ font-size:100%; height:100%; } body { background:#8b909c url('../images/page-bg.gif') repeat-x; height:100%; font-family:"Trebuchet MS", Verdana, Arial, Helvetica, sans-serif; } a{ text-decoration:none; color:#00a8cc; } a:hover{ text-decoration:underline; color:#00a8cc; } p{ font: 0.9em/1.2em "Trebuchet MS", Verdana, Arial, Helvetica, sans-serif; } h1{ font: 1.5em/1.5em "Trebuchet MS", Verdana, Arial, … |
| | Hello! Good morning. I am a newbie to perl. Sorry for the "stupid" question. Need your help on a perl one liner. Can't figure out how to add into the line. Currently have the following line: perl -pi -e 's='\{"$Poly_Map"=\{"$Poly_Map"F= temp_list This to search something like: A1_0 {A1_0 size by … |
| | Helllo all, well I am trying to split a file on the basis of space first and then trying to join it with "-" but i am not able to do it, can sumone please suggest what should I do in order to do it. I am attaching the required … |
| | I have a txt file as an input. It is a list which looks like this: [COLOR="Red"]A12345 B153875 C34893 ... ...[/COLOR] and I have a database file which looks like this: [COLOR="Green"]A12345 detail information nvonafwenfovosdncsjdnfoewhuwerhwieufhiudhfisdfnsd sdofnowerugfeuhgfurhgiuwerhfjdshfiasdhifheruwufhi irgfiweurgf A246 detail information isdofnowerugfeuhgfurhgiuwerhfjdshfiadhifheruwufhi wgerjgneiguihuhdnvkjdnvkjbdegiauberiubgieubgridfb ooogrngoawerngiauengugbuivrug B153875 detail information wgerjgneiguihuvkwwjddnvkegtiaugberijubgieubgridfb eragnowergnoweungfiousdhiuhsdnjkfnsk C34893 detail … |
| | Hi, Well I am getting this warning while running my script which is attached:Use of uninitialized value in concatenation (.) or string at aj.pl in this line : print OUTFILE"$address[$k]|" as when i remove this line I don't get any warnings: Can someone please tell me what is wrong with … |
 | Well, I want to have a program make a graph from the data that it has, so I looked up how to do that in Perl. The GD::Graph module came up. The problem is, that I tried installing GD previously and it did not work. I have tried every trick … |
| | This is actually a CGI issue I am having but Perl seems to be the closest forum here. I am having a very simple (hence very frustrating) problem with a CGI/Perl script. For some reason if I pas things from a checkbox they all get passed fine but the last … |
| | having this problem for first time. Keyboard keys not responding properly. Its not typing the wrong words. But actually opens up different windows with different keys. Like with "R" it will open "RUN" command dilog box and with "F" opens SEARCH. And then suddenly START will flash and keyboard will …  |
| | Hi all ! Can anybody tell me why the following code is not copying the file from source to destination? Thakns in advance........ use File::Copy; my $source="C:\\shared\\8.4.1\\DXSI"; my $dest="C:\\r45"; my @files; my $file; opendir(DIR, $source) or die "can't opendir $source: $! \n"; @files=readdir(DIR); close DIR; foreach $file(@files) { print "\n … |
| | I am migrating scripts from UNIX server to a Linux. In the perl script it calls rcp to transfer files. It worked ok in UNIX but not in Linux, which has scp, I dont want to do scp now as this is a temporary Linux Box I am using. I … |
| | Hi, I'm a newbie in Perl programming. I have to start/stop the Windows services running on the remote machine. So, I’m writing a script in Perl to accomplish this job. So far, I’ have completed the following tasks. • to access the windows services through Perl in my local machine. …  |
| | Hello all. I was trying to execute wget from the perl under windows vista. In cmd i can easily run wget because its in \windows\system32 folder. But from perl,when i try both system('wget --h'); and system('c:\windows\system32\wget --h'); i get the next error : 'wget' is not recognized as an internal … |
The End.