15,192 Topics

Member Avatar for
Member Avatar for cgfxcoloneill

I am starting to learn python and since I have had some programming before ( intro to java last semester and intro to c++ a couple years ago) the teacher gave me an interesting problem to solve. It is an equation called the Prandtl equation from fluid flow measurement it …

Member Avatar for cgfxcoloneill
0
263
Member Avatar for rasizzle

i'm trying to create a simple minimum function by comparing items in a list to each other. [code] list1 = [4,20,2,19,3254,234,21,03] for i in list1: if list[0] < list[0+i]: print i [/code] basically my thought process in pseudocode is for all items in the list if item n is less …

Member Avatar for woooee
0
111
Member Avatar for TerabyteST
Member Avatar for chg

I'm really kind of stuck here, and would really appreciate some help. I have a function that reads from a csv that can get quite large, and it will block some other routines from running in there allocated time slice. I need to make this code “non-blocking”. I think there …

Member Avatar for chg
0
249
Member Avatar for rbracco

Hi, I am using Python's urllib2 with Tor as a proxy to access a website. When I open the site's main page it works fine but when I try to view the login page (not actually log-in but just view it) I get the following error... URLError: To counteract this …

0
48
Member Avatar for TerabyteST

Is it possible? I need to use them with wxpython and I'd want to make a standalone program that contains them into the exe file.

Member Avatar for scru
0
116
Member Avatar for willemou

Hi, I hope you can help; I get this error when I compile a "C" sub module (NOT POSIX) 27 ! regmatch_t pmatch[2]; ===========> ............a......b............................................... *=ERROR===========> a - CCN3766 The universal character name "[" is not in the allowable range for an identifier. *=ERROR===========> b - CCN3275 Unexpected text ']' …

Member Avatar for willemou
0
82
Member Avatar for shevy24

hello all, how can i write a python line of codes that will contain WI-FI, google maps,google android applications on S60 nokia phone using a SKYHOOK wireless device as an acess point and the operating system must be symbian OS. But i have S60 developmental tools and S60wpsapi which i …

Member Avatar for lllllIllIlllI
0
89
Member Avatar for poeticinsanity

I'm attempting to search a string for a certain sequence. I have not done anything with re, and it is... a bit confusing. I'm looking for this string: <div class="indexcenter"> (there's a portion of text here using newlines and characters) <!-- end indexcenter --> I am thinking something alone these …

Member Avatar for poeticinsanity
0
94
Member Avatar for StarZ

Hi all. I'm making a program about 'reading and writing text files' The assignment I have to do is suppose to look like this: [url]http://i39.tinypic.com/5554wi.jpg[/url] But I can't figure it how to make it so when it keeps looping until the user types in 'break' and it will list the …

Member Avatar for vegaseat
0
175
Member Avatar for planetPlosion

I'm trying to print diff.txt that contains the differences between the 2 log files I have. I want it to print the diff.txt in the current directory, but I get nothing. [code] def difference(dirList1, dirList2): difFile = list(set(dirList1).difference(set(dirList2))) writeDif = open( 'diff.txt', 'w' ) writeDif.write( 'Yadda yadda, intro intro' ) …

Member Avatar for vegaseat
0
85
Member Avatar for mattyd

This demonstration was originally proposed to be posted as a Python tutorial but with further inspection it was deemed more of a "how-to" guide, in this case, how-to create simple animation via Tkinter (Tool Kit Interface) All the necessary elements are included in the attched zip file. This includes: [LIST] …

Member Avatar for vegaseat
1
242
Member Avatar for pymatio

How would you count how many opening HTML tags there were & then closing tags in a line? eg [CODE] for line in something: for match in re.match("[I]opening_regex_here[/I]",line): # will match <H1> or <html> or whatever opentags += 1 for match in re.match("[I]closing_regex_here[/I]",line): # will match <H1> or </html> or …

Member Avatar for vegaseat
0
3K
Member Avatar for sravan953

I have a string, say for example: [CODE]str="aasd<script>"[/CODE] How do I make Python to note down one character at a time until it encounters the '<'? I know it has to be a loop, but which function? Thanks

Member Avatar for siddhant3s
0
105
Member Avatar for sravan953

Hey guys.... I use Python 2.6.2. I recently created a program which accepts commands from my website, here's the code I used: [CODE]import urllib import subprocess import time open_site=urllib.urlopen("http://www.sravan953.webs.com/command_python.htm") read_site=open_site.read() def run_program(): current=time.asctime() print 'Runnning program'+' ['+current+']' subprocess.call(read_site) def check_argument(): current=time.asctime() if read_site=='': print 'No command given'+' ['+current+']' timer() else: …

Member Avatar for vegaseat
0
160
Member Avatar for tomtetlaw

I am using pygame I want my program to read an image file that only has black on it and whenever the character moves over a part that has black on it, he stops moving, any ideas on how to get started? The black image is not to be shown.

Member Avatar for tomtetlaw
0
281
Member Avatar for pymatio

I have the following script: [CODE] import sys import os import re pages = [] if len(sys.argv) > 1: for root, dirs, files in os.walk(sys.argv[1]): for f in files: filename = os.path.join(root, f) if (filename.endswith('.html')) or (filename.endswith('.htm')): pages.append(filename) for page in pages: f = open(page, "r") count = 1 for …

Member Avatar for pymatio
0
117
Member Avatar for leegeorg07

Hi, is there an internal module / method to change the colour of the text in the pythonwin? I am asking this so that I can make more exciting text based games

Member Avatar for leegeorg07
0
2K
Member Avatar for sciguy77

Hi, I'm trying to build a web server in Python, and here is what I have so far: [CODE] Code: from http.server import HTTPServer, BaseHTTPRequestHandler class RequestHandler(BaseHTTPRequestHandler): def _writeheaders(self): self.send_response(200) self.send_header('Content-type', 'text/html') self.end_headers() def do_HEAD(self): self._writeheaders() def do_GET(self): self._writeheaders() self.wfile.write("""<HTML> <HEAD><TITLE>Sample title</TITLE></HEAD> <BODY>sample text</BODY> </HTML>""") serveraddr = ('', 8080) srvr …

Member Avatar for sciguy77
0
160
Member Avatar for njparton

I'm stuck trying to get mechanize working as part of a larger project I'm working on. I'm trying to logon to the following website which I am registered at (but not as "bob" as below obviously): [url]http://www.morningstar.co.uk/uk/membership/signup.aspx?loginType=1&lastvisit=%2fuk%2fportfoliomanager%2fportfolio.aspx%3fSite%3duk%26lang%3den-GB[/url] I think I've managed to select the correct form (?) but I'm getting …

Member Avatar for njparton
0
208
Member Avatar for yamman13

Hey I'm new here registered today. I've been trying to import some definitions from other .py files in the same folder, but for some reason IDLE wont recognize/ import them and keeps telling me they arent defined. I have tried From file import * and was wondering if my syntax …

Member Avatar for jlm699
0
66
Member Avatar for fellixombc

I'm brand new to python, so i need a bit help parsing. Why i need parsing? so my irc bot can reconignise me. here is my code: [CODE]#### # Made by Fellixombc # pythonbots.no-ip.org:8080 (coming soon) # Contact: Fellixombc@hotmail.com (add me on msn, I don't check my email's) # Copyright …

0
63
Member Avatar for infinitelygreen

Hello! I recently started learning Python, and I'm trying to install the package GASP ([url]http://pypi.python.org/pypi/gasp/0.4.5[/url]) in order to be able to code some graphics. However, the file is of type EGG. I found that I need to install EasyInstall in order to be able to install EGG files. (The download …

Member Avatar for infinitelygreen
0
94
Member Avatar for darkwing

Hi all, I'm trying to write a video player with wxpython and pygst. The main Frame has one panel and one notebook. On one page of the notebook, I need to play multiple videos at the same time. On this page, I declare two CameraPanel instances (code below) and put …

0
64
Member Avatar for leegeorg07

Hi, I have this code: [code=python] def yn(input): if input.lower == 'y': return True else: return False def limestone(): I = raw_input("are there shelly fragments? (y/n)") if yn(I): print "Shelly limestone" else: print "chalk" def crystals(): I = raw_input("Are the crystals big?(y/n)") if yn(I): big_crystals() else: print "Basalt" def big_crystals(): …

Member Avatar for leegeorg07
0
69
Member Avatar for poeticinsanity

I'm having a simple problem. I'm using this class to do some stuff with another module. Now, for some reason the self.database and other variables are not able to be accessed by the other methods. I thought _init_ was suppose to work as a constructor, thus the other methods should …

Member Avatar for poeticinsanity
0
86
Member Avatar for tomtetlaw

How do I search a string for anything? What I mean is, I need to say: [code=python] if line == 'playername = (any name)': temp = line.strip().replace('playername=', '') return temp [/code] Any ideas?

Member Avatar for jlm699
0
106
Member Avatar for max.yevs

Ok, so this is kind of a complicated question... but... Ok so I have a python script, you enter some numbers it gives you some numbers back that sort of thing. But of course right now it just looks like a black window with text. kind of like [URL="http://blog.benhall.me.uk/images/InstallingWindows2008EnterpriseCoreServe_F3A1/6Cmd.jpg"]this.[/URL] But …

Member Avatar for vegaseat
0
148
Member Avatar for codedhands

Hello everyone,i am pretty new to GUI programming,am currently playing around with PyQt4.I would like to know how the ui for yahoo was created.Because the controls provided by pyqt are just normal gray-colored stuffs.Could it be that those fancy control or widgets are graphical images done with photoshop,gimp etc? Please …

Member Avatar for scru
0
98
Member Avatar for EGG123

I need to take a text file of a number of gene sequences in fasta format eg >geneA agctactactacgatcgaacgtagctactactacgatcgaacgtagctactactacgatc gaacgtagctactactacgatcgaacgtagctactactacgatcgaacgtagctactact acgatcgaacgtagctactactacgatcgaacgtagctactactacgatcgaacgtagct actactacgatcgaacgtagctactactacgatcgaacgtagctactactacgatcgaac gtagctactactacgatcgaacgtactacgatcgaacgta and put it into: geneA agctactactacgatcgaacgtagctactactacgatcgaacgtagctac where all of the sequence is on one line. I can concatenate it in excel for one sequence but i have …

Member Avatar for woooee
0
102

The End.